CBSE Class 12 Biology Set 3 Question Paper PDF (Code: 57/3/3) is now available for download. CBSE conducted the Class 12 History examination on March 19, 2024, from 10:30 AM to 1:30 PM.

The question paper consists of 33 questions carrying a total of 70 marks. Section A includes 16 MCQs for 1 mark each, Section B contains 5 very short-answer questions for 2 marks each, Section C comprises 7 short-answer questions for 3 marks each, Section D comprises 2 Case-based questions carries 4 marks each and Section E comprises 3 long-answer questions carries 5 marks each. Candidates can use the link below to download the CBSE Class 12 Biology Set 3 Question Paper with detailed solutions.

CBSE Class 12 Biology Question Paper 2024 (Set 3- 57/3/3) with Answer Key

CBSE Class 12 2024 Biology​ Question Paper with Answer Key download iconDownload Check Solution

CBSE Class 12 2024 Biology Questions with Solutions

SECTION A

Question 1:

Embryo formation without fertilization is observed in some species of:

  1. Maize
  2. Rose
  3. Mango
  4. Rice
Correct Answer: (3) Mango
View Solution

Solution:
- Apomixis is a unique process where embryos form without fertilization.
- In species like Mango, apomictic reproduction occurs, allowing seeds to develop from somatic or gametophytic cells.
- This ensures genetic consistency as the offspring are genetically identical to the parent plant.

Question 2:

The origin of life according to the early Greek philosophers was transfer of unit of life from outer space to the different planets in the form of:

  1. seeds
  2. spores
  3. gemmules
  4. gametes
Correct Answer: (2) spores
View Solution

Solution:
- The theory of Panspermia suggests that life is distributed across the universe via celestial objects like comets or meteoroids.
- According to this hypothesis, life on Earth may have originated from spores or microscopic life forms that traveled through space and reached Earth.
- These life-bearing entities could survive harsh cosmic conditions and initiated life on Earth upon finding suitable conditions.

Question 3:

The ploidy of apomictic embryos developing from the nucellus and antipodal cells respectively would be:

  1. 2n, 3n
  2. 2n, n
  3. 3n, 2n
  4. n, 2n
Correct Answer: (2) 2n, n
View Solution

Solution:
- In apomictic reproduction, embryos may arise from nucellus (somatic cells) or gametophytic tissue.
- Nucellus cells are somatic and hence diploid (2n). Thus, apomictic embryos from nucellus cells have a ploidy of 2n.
- Antipodal cells are part of the female gametophyte, which is haploid (n) due to their origin from meiotic division.
- Therefore, the ploidy of embryos is 2n for nucellus-derived and n for antipodal-derived embryos.

Question 4:

A DNA fragment has 3000 nucleotides, out of which 160 are Guanine. How many bases having double hydrogen bonds between them does this DNA fragment possess?

  1. 160
  2. 320
  3. 1340
  4. 2680
Correct Answer: (4) 2680
View Solution

Solution:
- Adenine (A) pairs with Thymine (T) via 2 hydrogen bonds, while Guanine (G) pairs with Cytosine (C) via 3 hydrogen bonds.
- Given: Total nucleotides = 3000, Guanine (G) = 160.
- Cytosine (C) = 160 (as G pairs with C).
- Remaining nucleotides form A-T pairs:
A + T = Total nucleotides - (G + C) = 3000 - (160 + 160) = 2680.
- Thus, the number of bases forming double hydrogen bonds is 2680.

Question 5:

After the 1850s in the post-industrialization era in England, the expected effect of natural selection on the number of white-winged moths as compared to the dark-winged moths was:

  1. Less in number
  2. More in number
  3. Both were less in number
  4. Both were more in number
Correct Answer: (1) Less in number
View Solution

Solution:
- During industrialization, tree trunks darkened due to soot, favoring the camouflage of dark-winged moths.
- As a result, dark-winged moths were less visible to predators and their numbers increased.
- In contrast, white-winged moths became more visible to predators, leading to a decline in their population.
- This phenomenon demonstrates natural selection driven by environmental changes.

Question 6:

In which of the following chromosomal disorders do the individuals have short stature, small head, furrowed tongue, and partially open mouth?

  1. Turner's syndrome
  2. Down's syndrome
  3. Klinefelter's syndrome
  4. Edwards' syndrome
Correct Answer: (2) Down's syndrome
View Solution

Solution:
- Down's syndrome is caused by trisomy of chromosome 21, meaning there are three copies of this chromosome instead of two.
- The disorder is characterized by:
- Short stature and small head size.
- A furrowed tongue and partially open mouth.
- Cognitive impairments and developmental delays.
- This condition arises due to nondisjunction during meiosis.

Question 7:

A Snapdragon plant bearing pink-colored flowers is crossed with a Snapdragon plant bearing white-colored flowers. Their F1 progeny will show:

  1. 25% Red : 50% Pink : 25% White
  2. 50% Red : 50% White
  3. 50% Pink : 50% White
  4. 25% Pink : 50% Red : 25% White
Correct Answer: (3) 50% Pink : 50% White
View Solution

Solution:
- Snapdragon plants exhibit incomplete dominance, where the heterozygous genotype results in an intermediate phenotype.
- A pink flowered plant has the genotype Rr, while a white flowered plant has the genotype rr.
- The cross is represented as:
Rr x rr → Gametes: R, r and r, r
F1 Progeny: 50%Rr(Pink) and 50%rr(White).

Question 8:

A patient is suffering from the infection of the alveoli of lungs and is showing the symptoms of fever, chills, cough, headache, and bluish-colored lips and fingernails. The patient was diagnosed to be suffering from the infection of:

  1. Epidermophyton
  2. Entamoeba histolytica
  3. Haemophilus influenzae
  4. Salmonella typhi
Correct Answer: (3) Haemophilus influenzae
View Solution

Solution:
- Haemophilus influenzae is a bacterial pathogen responsible for pneumonia, an infection of the alveoli in the lungs.
- Symptoms include: - Fever, chills, and cough.
- Cyanosis, which causes bluish lips and fingernails due to reduced oxygen levels.
- Additional symptoms like headache and difficulty breathing.

Question 9:

The linking of the antibiotic resistance gene with the plasmid vector of *Salmonella typhimurium* by Stanley Cohen and Herbert Boyer was made possible by the enzyme:

  1. Taq polymerase
  2. DNA ligase
  3. Restriction endonuclease
  4. -galactosidase
Correct Answer: (2) DNA ligase
View Solution

Solution:
- Stanley Cohen and Herbert Boyer pioneered recombinant DNA technology by linking the antibiotic resistance gene to the plasmid vector.
- DNA ligase was the enzyme that joined the DNA fragments by forming phosphodiester bonds between the sugar and phosphate groups.
- This experiment laid the foundation for genetic engineering and the creation of recombinant DNA molecules.

Question 10:

In an experiment, *E. coli* is grown in a medium containing 14NH4Cl (14N is the light isotope of Nitrogen) followed by growing it for six generations in a medium having the heavy isotope of nitrogen (15N). After six generations, their DNA was extracted and subjected to CsCl density gradient centrifugation. Identify the correct density (Light/Hybrid/Heavy) and ratio of the bands of DNA in CsCl density gradient centrifugation:

  1. Hybrid : Heavy, 1 : 16
  2. Light : Heavy, 1 : 31
  3. Hybrid : Heavy, 1 : 31
  4. Light : Heavy, 1 : 05
Correct Answer: (3) Hybrid : Heavy, 1 : 31
View Solution

Solution:
- In the first generation, all DNA will be hybrid (one strand 14N, one strand 15N).
- With successive generations in the 15N medium, the proportion of hybrid DNA decreases, while heavy DNA (15N) increases.
- After six generations, the DNA bands will show a ratio of 1:31 for hybrid to heavy DNA.
- This result is due to the exponential replication of 15N-labeled DNA in the absence of 14N.

Question 11:

The population growth curve applicable for a population of beetles growing in nature under unlimited resource conditions available to them will be:

  1. Image A
  2. Image B
  3. Image C
  4. Image D
Correct Answer: (3) Exponential growth curve
View Solution

Solution:
- In an ideal environment with unlimited resources, population growth follows an exponential pattern.
- The population size increases at a constant rate, represented mathematically as: Nt = N0ert
where Nt is the population at time t, N0 is the initial population, and r is the intrinsic growth rate.
- This results in a J-shaped curve, where the population doubles at regular intervals.
- Such conditions rarely occur in nature due to limiting factors like food, space, and predation.

Question 12:

Which one of the following represents the correct annealing of primers to the DNA to be amplified in the PCR?

  1. Image A
  2. Image B
  3. Image C
  4. Image D
Correct Answer: (2) Primers anneal perfectly in opposite directions to the DNA template.
View Solution

Solution:
- PCR (Polymerase Chain Reaction) is used to amplify a specific segment of DNA.
- Primers are short nucleotide sequences designed to bind to opposite strands of the DNA template in a complementary manner.
- The binding occurs at the 3' ends of the primers, allowing DNA polymerase to extend the sequence in the 5' to 3' direction.
- This ensures amplification of the target DNA region between the primer binding sites.

Question 13:

Assertion (A): The zygote gives rise to heart-shaped embryo and subsequently proembryo in most angiosperms.

Reason (R): The zygote is present at the micropylar end of the embryo sac and develops into an embryo.

Options:

  1. Both (A) and (R) are true, and (R) is the correct explanation of (A).
  2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
  3. (A) is true, but (R) is false.
  4. (A) is false, but (R) is true.
Correct Answer: (4) (A) is false, but (R) is true.
View Solution

Solution:
- The zygote in angiosperms develops into a heart-shaped embryo before transitioning into the proembryo stage. This is a key stage of embryogenesis.
- The zygote is indeed located at the micropylar end of the embryo sac, but this does not explain the heart-shaped stage.
- The heart-shaped embryo results from cell differentiation and tissue patterning during embryogenesis.
- Thus, both statement (A) is false but (R) is true

Question 14:

Assertion (A): The stirrer facilitates the even mixing of oxygen availability in a bioreactor.

Reason (R): Stirred-tank bioreactors generally have a flat base.

Options:

  1. Both (A) and (R) are true, and (R) is the correct explanation of (A).
  2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
  3. (A) is true, but (R) is false.
  4. (A) is false, but (R) is true.
Correct Answer: (3) (A) is true, but (R) is false.
View Solution

Solution:
- In a stirred-tank bioreactor, the stirrer facilitates the even distribution of oxygen and nutrients throughout the culture medium.
- The flat base of a bioreactor provides structural stability, but it has no role in oxygen mixing.
- Thus, while the assertion (A) is correct, the reason (R) is incorrect.

Question 15:

Assertion (A): Primary transcripts in eukaryotes are subjected to splicing to remove the introns.

Reason (R): Primary transcripts contain both exons and introns, and the introns are non-functional in eukaryotes.

Options:

  1. Both (A) and (R) are true, and (R) is the correct explanation of (A).
  2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
  3. (A) is true, but (R) is false.
  4. (A) is false, but (R) is true.
Correct Answer: (1)
View Solution

Solution:
- Eukaryotic primary transcripts are processed to remove non-functional regions called introns. This process is called splicing.
- The primary transcript consists of both exons (functional coding regions) and introns (non-functional sequences).
- Splicing ensures that only exons remain in the mature mRNA, which is then translated into proteins.
- The assertion (A) is correct as splicing removes introns, and the reason (R) correctly explains the presence of both exons and introns in the primary transcript.

Question 16:

Assertion (A): The chronic use of alcohol by a person leads to cirrhosis.

Reason (R): Alcohol addiction at times becomes the cause of mental and financial distress to the entire family of the addicted person.

Options:

  1. Both (A) and (R) are true, and (R) is the correct explanation of (A).
  2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
  3. (A) is true, but (R) is false.
  4. (A) is false, but (R) is true.
Correct Answer: (2)
View Solution

Solution:
- Chronic alcohol consumption damages liver cells, leading to cirrhosis, a condition where the liver is scarred and its function is impaired.
- While alcohol addiction may cause mental and financial distress to families, this is unrelated to the physiological process of cirrhosis development.
- Thus, both the assertion and reason are correct, but the reason is not the correct explanation of the assertion.

SECTION B

Question 17:

Amniocentesis is a very useful and important technique, but due to some reason there is a statutory ban on amniocentesis. Justify this statement.

View Solution

Solution:
- Amniocentesis is a prenatal diagnostic technique used to detect genetic disorders and chromosomal abnormalities in the fetus.
- However, it is banned in many countries due to its misuse for determining the sex of the fetus, which may lead to:
1. Female feticide, causing a decline in the female-to-male ratio.
2. Ethical concerns regarding the deliberate termination of pregnancies based on the fetus's sex.
3. Social and cultural issues promoting gender discrimination.

Question 18(a):

With reference to the set-ups (A, B, and C) given below, of the electrophoretic separation of a mixture of DNA fragments of varied lengths, answer the questions that follow:

Electrophoresis Setups

(a) In which one of the two Set-ups, A or B, would you see the DNA fragments separated and why?

View Solution

Solution:
- Set-up B. DNA fragments are negatively charged and migrate toward the positive electrode (anode) under an electric field. Set-up B correctly places the positive electrode opposite the sample, ensuring proper separation.

Question 18(b):

(b) In Set-up C, which one of the two, I/II, are the bands of longer fragments of DNA? Justify your answer.

View Solution

Solution:
- Band II contains longer DNA fragments. Larger molecules move more slowly through the gel matrix compared to smaller fragments, causing them to remain closer to the loading well.

Question 19(a):

Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow:
mRNA Sequence: 5’– UCAUUAACCCAGAUCUUCUUAAAAGGA –3'
(a) How many amino acids will be formed from the given codons, if substitution of 'U' by 'C' takes place at the 5th codon? Explain your answer.

View Solution

Solution:
- After substitution, the sequence changes to: 5'-UCAUU AACCC AGACCUUCUU AAAAGGA-3'.
- The 5th codon changes from UCU (Serine) to CCU (Proline). The total number of codons encoding amino acids remains the same.
- Amino acids = Total codons – Stop codon = 8.

Question 19(b):

(b) Write the number of amino acids that would be in the polypeptide synthesized by a similar mRNA as above, where in the fourth codon instead of 'C' there is 'U'. Justify your answer.

View Solution

Solution:
- The sequence changes to: 5′-UCAUU AAUCC AGAUCUUCUU AAAAGGA-3'.
- This causes the fourth codon to become UAA, a premature stop codon, halting translation.
- The polypeptide chain will be shorter as translation stops earlier.

Question 20:

Write important features of ‘humus' formed during the decomposition cycle in a terrestrial ecosystem.

View Solution

Solution:
- Humus is a dark, organic material formed by the decomposition of plant and animal matter.
Key features include:
1. Rich in nutrients: Humus provides essential nutrients for plant growth.
2. Improves soil fertility: Enhances water retention and microbial activity.
3. Resistant to decomposition: Remains in the soil for a long time, supporting ecosystem stability.

Question 20(b)(i):

Graphically represent the relationship between species richness and area on a log-log scale for bats and fishes.

View Solution

Solution: The graph shows a logarithmic relationship, with species richness increasing with area.
Species Richness vs Area Graph

Question 20(b)(ii):

Write the equation for the relationship as on a logarithmic scale.

View Solution

Solution: S = cAz, where:
• S = Species richness.
• A = Area.
• c = Constant.
• z = Slope of the line (logarithmic).

Question 21:

What is a vaccine? Write the basis on which it acts when administered in the body.

View Solution

Solution:
- A vaccine is a biological preparation that provides active immunity against specific diseases.
- It contains inactivated or weakened pathogens/antigens that stimulate the immune system to:
1. Recognize and neutralize pathogens upon future exposure.
2. Produce memory cells for long-term immunity.

SECTION C

Question 22:

Draw a T.S. of a mature anther of an angiosperm. Label its any three wall layers and mention their functions.

View Solution

Solution:
The transverse section (T.S.) of a mature anther includes the following wall layers:
• Epidermis: The outermost layer that provides mechanical protection.
• Endothecium: Helps in the dehiscence of the anther to release pollen grains.
• Tapetum: Nourishes developing pollen grains by supplying nutrients and enzymes.
Anther Diagram

Question 23:

A population of snakes lived in a desert with brown sand. Study the drawings given below showing the change in the population from ‘one' to 'two' over time and answer the question that follows. Brown snakes and grey snakes are represented by alleles A/a (Dominant/recessive).

Snakes Population

(a) If the frequency of the recessive trait is 9% in population-one, work out the frequency of homozygous dominant and heterozygous dominant snakes.

View Solution

Solution:
Given: Recessive trait frequency (q²) = 9% = 0.09.
q2 = 0.09 => q = √0.09 = 0.3.
p + q = 1 => p = 1 – 0.3 = 0.7.
Homozygous dominant (AA) frequency: p2 = (0.7)2 = 0.49 = 49%.
Heterozygous dominant (Aa) frequency: 2pq = 2(0.7)(0.3) = 0.42 = 42%.

Question 23(b):

Name the mechanism of evolution that must have operated so that population-two evolved from population-one.

View Solution

Solution:
The mechanism is Natural Selection. Brown snakes had better camouflage in the desert environment, leading to higher survival and reproductive success, whereas grey snakes were more visible to predators. Over generations, this selection led to an increased frequency of the brown allele.

Question 24(a)(i):

List two major reasons for using cow-dung in a biogas plant instead of using domestic sewage.

View Solution

Solution:
• Cow-dung contains methanogenic bacteria that are highly efficient in producing biogas.
• It is readily available in rural areas and environmentally sustainable as a resource.

Question 24(a)(ii):

Mention one use of the unspent slurry of the biogas plant.

View Solution

Solution:
Unspent slurry is used as a nutrient-rich organic fertilizer, improving soil fertility and supporting sustainable agriculture.

Question 24(b):

Name the bioactive molecule and its microbial source generally used by physicians to treat the patients for:

• (i) Myocardial infarction

• (ii) High blood cholesterol level

• (iii) Organ transplantation

View Solution

Solution:
• (i) Myocardial infarction: Streptokinase (source: *Streptococcus*).
• (ii) High blood cholesterol level: Statins (source: *Monascus purpureus*).
• (iii) Organ transplantation: Cyclosporine A (source: *Trichoderma polysporum*).

Question 25:

Differentiate between spermatogenesis and oogenesis in humans on the basis of the following:

(a) When the process is initiated.

(b) Number of functional gametes produced per primary spermatocyte/oocyte.

(c) Specific site at which meiosis II is completed.

View Solution

Solution:
(a) When the process is initiated.
• Spermatogenesis: Begins at puberty.
• Oogenesis: Begins during fetal development.

(b) Number of functional gametes produced per primary spermatocyte/oocyte.
• Spermatogenesis: Produces four functional sperm from one primary spermatocyte.
• Oogenesis: Produces one ovum and two polar bodies from one primary oocyte.

(c) Specific site at which meiosis II is completed.
• Spermatogenesis: Completed in the seminiferous tubules of the testes.
• Oogenesis: Completed in the fallopian tubes after fertilization.

Question 26:

Three crosses were carried out in pea plants with respect to flower colour violet/white (V/v) and flower position axial/terminal (A/a). Study in the table the crosses 'a', 'b' and ‘c' where parental phenotypes and their F₁ progeny phenotypes are given. Find the genotypes of each of the parental pairs of crosses 'a', 'b' and 'c'.

Parental plants (Phenotypes) F₁ Progeny (Phenotypes)
(a) Violet, axial × white, axial 6/16 white, axial
2/16 white, terminal
6/16 violet, axial
2/16 violet, axial
(b) Violet, axial × white, terminal 1/4 violet, axial
1/4 violet, terminal
1/4 white, axial
1/4 white, terminal
(c) Violet, axial × violet, axial 3/4 violet, axial
1/4 white, axial
View Solution

Solution:
(a) Cross: Violet, axial × White, axial
Genotype of parents: *VvAa* × *vvAa*
Explanation:
• 6/16 Violet, axial: *VvAa*.
• 2/16 White, terminal: *vvAa*.

(b) Cross: Violet, axial × White, terminal
Genotype of parents: *VvAa* × *vvaa*
Explanation:
• 1/4 Violet, axial: *VvAa*.
• 1/4 Violet, terminal: *Vvaa*.
• 1/4 White, axial: *vvAa*.
• 1/4 White, terminal: *vvaa*.

(c) Cross: Violet, axial × Violet, axial
Genotype of parents: *VvAa* × *VvAa*
Explanation:
• 3/4 Violet, axial: *V_Aa*.
• 1/4 White, axial: *vvAa*.

Question 27:

Explain any three roles of ‘predation' in an ecosystem with the help of suitable examples.

View Solution

Solution:
Roles of predation:
• Maintains species diversity: Predators control prey populations, preventing any one species from dominating. Example: Tigers preying on herbivores in forests.
• Regulates ecosystem balance: Predators prevent overgrazing by herbivores, maintaining a balance between plant and animal populations. Example: Wolves controlling deer populations in Yellowstone National Park.
• Promotes natural selection: Predation drives evolutionary adaptations in prey species to develop defense mechanisms. Example: Camouflage in stick insects and moths.

Question 28(a):

Give the scientific name of the bacteria widely used in biotechnology to create a GM cotton crop resistant to bollworm attacks.

View Solution

Solution:
*Bacillus thuringiensis* (*Bt*)

Question 28(b):

Explain how GM cotton crop is able to resist insect attacks.

View Solution

Solution:
GM cotton incorporates a gene from *Bacillus thuringiensis* to resist insect attacks:
• The *Bt* gene produces a toxin that becomes active in the alkaline gut of bollworms.
• The toxin binds to gut receptors, causing cell lysis, leading to the death of the insect.

SECTION D

Question 29:

Read the passage given below and answer the questions that follow:
In recombinant DNA technology, restriction enzymes are used as they recognize and cut DNA within a specific recognition sequence. *BamHI* is one such restriction enzyme which binds at the recognition sequence 5'-G↓GATCC-3' and cleaves this sequence between G and G on each strand, whereas *Alul* binds at the recognition sequence 5'-AG↓CT-3' and cleaves these sequences between G and C on each strand.

Question 29(a):

If *Alu l* is used to cut the given DNA strand, how many DNA fragments would be formed? Write the sequence of each fragment formed with its polarity.

29(a)

View Solution

Solution:
The sequence contains three *Alul* recognition sites. DNA fragments formed:
5'C-C-G-T-A-G-C-T-A-T-C-A-G-C-T-G-G 3'
3'G-G-C-A-T-C-G-A-T-A-G-T-C-G-A-C-C 5'
• 5'-CCGG-3'
• 5'-ATCCTG-3'
• 5'-CGAT-3'

Question 29(b):

Which one of the two restriction enzymes, *BamHI* or *AluI*, will preferably be used on the same given DNA strand to make a recombinant DNA molecule and why?

View Solution

Solution:
*BamHI* is preferred because it generates sticky ends, which facilitate the joining of DNA fragments to form recombinant DNA.

Question 29(c):

After binding to the two strands of the double helix DNA, where specifically does the restriction enzyme act to cut the two strands of DNA? Write the specific term used for the specific nucleotide sequences of DNA recognised by a restriction endonuclease.

View Solution

Solution:
Restriction enzymes cut DNA at specific recognition sites, which are typically palindromic sequences. These sequences enable the enzyme to cleave at precise locations, generating sticky or blunt ends.
• The specific term used for these sequences is recognition sequence.

Question 29(c)OR:

Write the specific sequence of DNA segment recognised by the restriction endonuclease EcoRI.

View Solution

Solution:
*EcoRI* recognises the palindromic DNA sequence 5'-GAATTC-3' and cleaves it between G and A, producing sticky ends.

Question 30:

Study the figures given below that depict the comparative age distribution of human populations in Sweden and Rwanda (International Data Base 2003) and answer the questions that follow:

Age Distribution

Question 30(a):

What can be inferred from the very broad base of Rwanda's age pyramid? Support your answer with the data provided in the figure.

View Solution

Solution:
The broad base of Rwanda's age pyramid indicates:
• High birth rate: A significant proportion of the population is in the younger age groups (0-14 years).
• Rapid population growth: As a developing nation, Rwanda has a higher fertility rate with more children being born than individuals dying.

Question 30(b):

Sweden has an age distribution that is approximately of the same width near its base as at the apex. What does this indicate?

View Solution

Solution:
Sweden's age pyramid indicates:
• Stable population: The population growth rate is low due to effective family planning and healthcare.
• Low birth and death rates: Nearly equal proportions of individuals in all age groups indicate balanced demographic growth.

Question 30(c):

Name the type of age pyramid shown above for Sweden.

View Solution

Solution:
Stationary age pyramid.

Question 30(d):

Name the type of age pyramid shown above for Rwanda.

View Solution

Solution:
Expanding age pyramid.

SECTION E

Question 31(a):

“The influence of both alleles in a heterozygous state is clearly expressed in codominance.” Explain with the help of inheritance of ABO blood group in humans.

View Solution

Solution:
Codominance occurs when both alleles in a heterozygous state are fully expressed without blending.
• Example: ABO blood group inheritance.
• The ABO blood group system involves three alleles: IA, IB, and i.
• The IA and IB alleles are codominant, while i is recessive.
• A person with the genotype IAIB will express both alleles equally, resulting in the AB blood group.

Question 31(b)(i)OR:

Explain the mechanism of switching ‘on' of the structural genes of the *lac operon*.

View Solution

Solution:
The *lac operon* is switched ‘on' in the presence of lactose:
• Lactose acts as an inducer by binding to the repressor protein, changing its conformation.
• The altered repressor cannot bind to the operator region of the operon.
• This allows RNA polymerase to bind to the promoter region and transcribe the structural genes (*lacZ*, *lacY*, *lacA*).
• The enzymes produced metabolize lactose, enabling its utilization as an energy source.

Question 31(b)(ii)OR:

“Regulation of *lac operon* is referred to as negatively regulated.” Justify giving a reason.

View Solution

Solution:
The *lac operon* is negatively regulated because:
• In the absence of lactose, the repressor protein binds to the operator region, preventing RNA polymerase from transcribing the structural genes.
• This ensures that the operon is inactive when lactose is unavailable, conserving energy.

Question 32(a)(i):

Describe the life cycle of *Plasmodium* from the time it enters the human body till a female *Anopheles* mosquito bites an infected person.

View Solution

Solution:
The life cycle of *Plasmodium*:
• Sporozoites enter the human bloodstream through a mosquito bite and travel to the liver.
• In liver cells, sporozoites multiply to form merozoites, which are released into the bloodstream.
• Merozoites infect red blood cells, causing them to rupture. This leads to malaria symptoms like fever and chills.
• Some merozoites develop into gametocytes, which circulate in the blood.
• When a mosquito bites an infected person, it ingests gametocytes, continuing the cycle.

Question 32(a)(ii):

Mention the two events of *Plasmodium* life cycle that occur within the female *Anopheles* body.

View Solution

Solution:
• Gametogenesis: Gametocytes develop into male and female gametes inside the mosquito.
• Sporozoite Formation: The zygote develops into sporozoites, which migrate to the salivary glands, ready to infect the next host.

Question 32(b)(i):

Write two differences between malignant tumor and benign tumor.

View Solution

Solution:
• Malignant Tumor:
- Malignant tumors are cancerous and invade nearby tissues, causing significant damage.
- They have the ability to metastasize, spreading to other parts of the body via blood or lymphatic systems.

• Benign Tumor:
- Benign tumors are non-cancerous and grow at a slower rate, staying confined to their original location.
- They do not invade surrounding tissues or metastasize to distant parts of the body.

Question 32(b)(ii):

Explain any three diagnostic techniques for the detection of cancer.

View Solution

Solution:
Three widely used diagnostic techniques for cancer detection are:
• Biopsy: Involves taking a small sample of tissue from the affected area, which is then analyzed under a microscope to check for cancerous cells.
• Imaging Techniques:
- X-rays: Effective for identifying abnormalities in bones or certain organs.
- MRI (*Magnetic Resonance Imaging*): Produces detailed cross-sectional images of soft tissues, helping to locate and assess tumors.
• Blood Tests: Used to detect tumor markers, which are specific proteins or substances produced by cancer cells.

Question 33(a)(i):

Explain any four devices that flowering plants have developed to encourage cross-pollination.

View Solution

Solution:
Flowering plants have evolved the following mechanisms to promote cross-pollination:
• Dichogamy: The male and female reproductive parts of a flower mature at different times to prevent self-pollination. For example, protandry (male matures first) in sunflower.
• Self-incompatibility: A genetic mechanism prevents the germination of self-pollen on the stigma, ensuring cross-pollination. Example: *Brassica* species.
• Herkogamy: Structural adaptation in which male and female organs are spatially separated, making self-pollination unlikely. Example: *Hibiscus*.
• Monoecy and Dioecy: In monoecious plants, male and female flowers are present on the same plant (e.g., maize), while in dioecious plants, they occur on separate plants (e.g., papaya).

Question 33(a)(ii):

Why do plants discourage self-pollination? State any one reason.

View Solution

Solution:
Plants discourage self-pollination because it leads to inbreeding depression, which reduces genetic variation and adaptability, making the population more susceptible to diseases and environmental changes.

Question 33(b):

Explain the ovarian and uterine events taking place along with the role of pituitary and ovarian hormones, during menstrual cycle in a normal human female under the following phases:

(i) Follicular phase/proliferative phase

(ii) Luteal phase/secretory phase

(iii) Menstrual phase

View Solution

Solution:
(i) Follicular phase/proliferative phase
• Ovarian events: A primary follicle develops into a mature Graafian follicle in the ovary.
• Uterine events: The endometrium of the uterus regenerates and thickens in preparation for possible implantation.
• Hormones:
- FSH (Follicle Stimulating Hormone): Promotes follicular growth and maturation.
- Estrogen: Secreted by the growing follicle, aiding in endometrial repair and stimulating LH secretion.

(ii) Luteal phase/secretory phase
• Ovarian events: The ruptured follicle transforms into the corpus luteum, which secretes progesterone.
• Uterine events: The endometrium thickens further, becoming more vascularized and glandular to prepare for embryo implantation.
• Hormones:
- Progesterone: Maintains the thickened endometrium and inhibits FSH and LH secretion.
- Estrogen: Supports the uterine lining.

(iii) Menstrual phase
• Ovarian events: If fertilization does not occur, the corpus luteum degenerates into the corpus albicans.
• Uterine events: The thickened endometrium breaks down, leading to menstrual bleeding.
• Hormones:
- Progesterone and Estrogen: Their levels decline, causing the breakdown of the uterine lining.
- FSH secretion increases: This initiates the next cycle by stimulating the growth of new follicles.