NEET 2023 Question Paper with Answers and Solutions PDF E3 in English

Physics : Section-A

Question 1:

The temperature of a gas is -50° C. To what temperature should the gas be heated so that the rms speed is increased by 3 times?

• (1) 669°C
• (2) 3295°C
• (3) 3097 K
• (4) 223 K

An ac source is connected to a capacitor C. Due to a decrease in its operating frequency:

• (1) capacitive reactance decreases.
• (2) displacement current increases.
• (3) displacement current decreases.
• (4) capacitive reactance remains constant.

Given below are two statements:

Statement I: Photovoltaic devices can convert optical radiation into electricity.
Statement II: Zener diode is designed to operate under reverse bias in the breakdown region.

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) \(\Omega\). The colour of the third band must be:

• (1) Red
• (2) Green
• (3) Orange
• (4) Yellow

If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by:

• (1) 200 \(\Omega\)
• (2) 50 \(\Omega\)
• (3) 100 \(\Omega\)
• (4) 400 \(\Omega\)

An electric dipole is placed at an angle of 30° with an electric field of intensity \(2 \times 10^5 \, N/C\). It experiences a torque equal to 4 Nm. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.

• (1) 8 mC
• (2) 6 mC
• (3) 4 mC
• (4) 2 mC

A vehicle travels half the distance with speed \( v \) and the remaining distance with speed \( 2v \). Its average speed is:

• (1) \( \frac{v}{3} \)
• (2) \( \frac{2v}{3} \)
• (3) \( \frac{4v}{3} \)
• (4) \( \frac{3v}{4} \)

The magnitude and direction of the current in the following circuit is:

• (1) 0.2 A from B to A through E
• (2) 0.5 A from A to B through E
• (3) \( \frac{5}{9} \) A from A to B through E
• (4) 1.5 A from B to A through E

In a series LCR circuit, the inductance \(L = 10\,mH\), capacitance \(C = 1\,\mathrm{\mu F}\), and resistance \(R = 100\,\Omega\). The frequency at which resonance occurs is:

• (1) 15.9 rad/s
• (2) 15.9 KHz
• (3) 1.59 rad/s
• (4) 1.59 KHz

Light travels a distance \(x\) in time \(t_1\) in air and \(10x\) in time \(t_2\) in another denser medium. What is the critical angle for this medium?

• (1) \( \sin^{-1}\left( \frac{t_2}{t_1} \right) \)
• (2) \( \sin^{-1}\left( \frac{10t_2}{t_1} \right) \)
• (3) \( \sin^{-1}\left( \frac{t_1}{10t_2} \right) \)
• (4) \( \sin^{-1}\left( \frac{t_1}{t_2} \right) \)

The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of \(V\) volts is proportional to:

• (1) \( \sqrt{V} \)
• (2) \( \frac{1}{V} \)
• (3) \( \frac{1}{\sqrt{V}} \)
• (4) \( V^2 \)

A bullet is fired from a gun at the speed of 280 m/s in the direction \(30^\circ\) above the horizontal. The maximum height attained by the bullet is (given \( g = 9.8 \, m/s^2 \), \( \sin 30^\circ = 0.5 \)):

• (1) 2800 m
• (2) 2000 m
• (3) 1000 m
• (4) 3000 m

A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor, and a load resistance. Which of these components removes the AC ripple from the rectified output?

• (1) A centre-tapped transformer
• (2) p-n junction diodes
• (3) Capacitor
• (4) Load resistance

The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly: (surface tension of soap solution = 0.03 N m\(^{-1}\))

• (1) \( 30.16 \times 10^{-4} \, J \)
• (2) \( 5.06 \times 10^{-4} \, J \)
• (3) \( 3.01 \times 10^{-4} \, J \)
• (4) \( 50.1 \times 10^{-4} \, J \)

The ratio of frequencies of fundamental harmonic produced by an open pipe to that of a closed pipe having the same length is:

• (1) 1:2
• (2) 2:1
• (3) 1:3
• (4) 3:1

Let a wire be suspended from the ceiling (rigid support) and stretched by a weight \(W\) attached at its free end. The longitudinal stress at any point of cross-sectional area \(A\) of the wire is:

• (1) \( \frac{2W}{A} \)
• (2) \( \frac{W}{A} \)
• (3) \( \frac{W}{2A} \)
• (4) Zero

A metal wire has mass \( (0.4 \pm 0.002) \, g \), radius \( (0.3 \pm 0.001) \, mm \), and length \( (5 \pm 0.02) \, cm \). The maximum possible percentage error in the measurement of density will nearly be:

• (1) 1.2%
• (2) 1.3%
• (3) 1.6%
• (4) 1.4%

For Young’s double slit experiment, two statements are given below:

Statement I: If the screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

The angular acceleration of a body, moving along the circumference of a circle, is:

• (1) along the radius, away from centre
• (2) along the radius towards the centre
• (3) along the tangent to its position
• (4) along the axis of rotation

In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of \(2.0 \times 10^{10}\) Hz and amplitude \(4 \, V/m\). Then the amplitude of oscillating magnetic field is: (Speed of light in free space = \(3 \times 10^8 \, m/s\))

• (1) \( 1.6 \times 10^{-9} \, T \)
• (2) \( 1.6 \times 10^{-8} \, T \)
• (3) \( 1.6 \times 10^{-7} \, T \)
• (4) \( 1.6 \times 10^{-6} \, T \)

The equivalent capacitance of the system shown in the following circuit is:

• (1) 2 μF
• (2) 3 μF
• (3) 6 μF
• (4) 9 μF

A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is:

• (1) along eastward
• (2) along northward
• (3) along north-east
• (4) along south-west

The venturi-meter works on:

• (1) Huygen’s principle
• (2) Bernoulli’s principle
• (3) The principle of parallel axes
• (4) The principle of perpendicular axes

The magnetic energy stored in an inductor of inductance 4 μH carrying a current of 2 A is:

• (1) 4 mJ
• (2) 2 mJ
• (3) 8 mJ
• (4) 4 mJ

Two bodies of mass \(m\) and \(9m\) are placed at a distance \(R\). The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant):

• (1) \( \frac{8 Gm}{R} \)
• (2) \( \frac{12 Gm}{R} \)
• (3) \( \frac{16 Gm}{R} \)
• (4) \( \frac{20 Gm}{R} \)

The work functions of Caesium (Cs), Potassium (K), and Sodium (Na) are 2.14 eV, 2.30 eV, and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?

• (1) Cs only
• (2) Both Na and K
• (3) K only
• (4) Na only

A 12V, 60 W lamp is connected to the secondary of a step-down transformer, whose primary is connected to AC mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?

• (1) 0.27 A
• (2) 2.7 A
• (3) 3.7 A
• (4) 0.37 A

The net magnetic flux through any closed surface is:

• (1) Zero
• (2) Positive
• (3) Infinity
• (4) Negative

The potential energy of a long spring when stretched by 2 cm is \(U\). If the spring is stretched by 8 cm, potential energy stored in it will be:

• (1) 2U
• (2) 4U
• (3) 8U
• (4) 16U

The half-life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to \( \frac{1}{16} \) of its initial value?

• (1) 20 minutes
• (2) 40 minutes
• (3) 60 minutes
• (4) 80 minutes

A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the sink is:

• (1) 27°C
• (2) 15°C
• (3) 100°C
• (4) 200°C

If \( \oint_S \vec{E} \cdot d\vec{S} = 0 \) over a surface, then:

• (1) the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
• (2) the magnitude of electric field on the surface is constant.
• (3) all the charges must necessarily be inside the surface.
• (4) the electric field inside the surface is necessarily uniform.

In hydrogen spectrum, the shortest wavelength in the Balmer series is \( \lambda \). The shortest wavelength in the Bracket series is:

• (1) \( 2\lambda \)
• (2) \( 4\lambda \)
• (3) \( 9\lambda \)
• (4) \( 16\lambda \)

The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are:

• (1) Instrumental errors
• (2) Personal errors
• (3) Least count errors
• (4) Random errors

The ratio of radius of gyration of a solid sphere of mass \(M\) and radius \(R\) about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is:

• (1) 3:5
• (2) 5:3
• (3) 2:5
• (4) 5:2

Physics : Section-B

Question 36:

Two thin lenses are of the same focal lengths \( f \), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be:

• (1) Zero
• (2) \( \frac{f}{4} \)
• (3) \( \frac{f}{2} \)
• (4) Infinite

In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?

• (1) 40 cm
• (2) -40 cm
• (3) -100 cm
• (4) -50 cm

The radius of the innermost orbit of a hydrogen atom is \( 5.3 \times 10^{-11} \, m \). What is the radius of the third allowed orbit of hydrogen atom?

• (1) 0.53 Å
• (2) 1.06 Å
• (3) 1.59 Å
• (4) 4.77 Å

10 resistors, each of resistance \(R\), are connected in series to a battery of emf \(E\) and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased \(n\) times. The value of \(n\) is:

• (1) 10
• (2) 100
• (3) 1
• (4) 1000

An electric dipole is placed as shown in the figure.

The electric potential (in \( 10^2 \) V) at point P due to the dipole is \( (\epsilon_0 = permittivity of free space and \frac{1}{4 \pi \epsilon_0} = K) \):

• (1) \( \frac{3}{8} \, qK \)
• (2) \( \frac{5}{8} \, qK \)
• (3) \( \frac{8}{5} \, qK \)
• (4) \( \frac{8}{3} \, qK \)

Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m/s\(^2\)).

• (1) 1.2 m/s\(^2\)
• (2) 150 m/s\(^2\)
• (3) 1.5 m/s\(^2\)
• (4) 50 m/s\(^2\)

For the following logic circuit, the truth table is:

 
View Solution

The \( x - t \) graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at \( t = 2 \, s \) is:

• (1) \( \frac{\pi^2}{8} \, ms^{-2} \)
• (2) \( \frac{-\pi^2}{8} \, ms^{-2} \)
• (3) \( \frac{\pi^2}{16} \, ms^{-2} \)
• (4) \( \frac{-\pi^2}{16} \, ms^{-2} \)

A bullet from a gun is fired on a rectangular wooden block with velocity \( u \). When the bullet travels 24 cm through the block along its length horizontally, the velocity of the bullet becomes \( \frac{u}{3} \). Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is:

• (1) 27 cm
• (2) 24 cm
• (3) 28 cm
• (4) 30 cm

A very long conducting wire is bent in a semi-circular shape from A to B as shown in the figure. The magnetic field at point P for steady current configuration is given by:

• (1) \( \frac{\mu_0 I}{4R} \) pointed into the page
• (2) \( \frac{\mu_0 I}{4R} \) pointed away from the page
• (3) \( \frac{\mu_0 I}{4R} \left[ 1 - \frac{2}{\pi} \right] \) pointed away from the page
• (4) \( \frac{\mu_0 I}{4R} \left[ 1 - \frac{2}{\pi} \right] \) pointed into the page

The net impedance of the circuit (as shown in the figure) will be:

• (1) \( 10 \sqrt{2} \, \Omega \)
• (2) 15 \( \Omega \)
• (3) \( 5 \sqrt{5} \, \Omega \)
• (4) 25 \( \Omega \)

A satellite is orbiting just above the surface of the earth with period \( T \). If \( d \) is the density of the earth and \( G \) is the universal constant of gravitation, the quantity \( 3 \pi \) represents:

• (1) \( T \)
• (2) \( T^2 \)
• (3) \( T^3 \)
• (4) \( \sqrt{T} \)

A wire carrying a current \( I \) along the positive \( x \)-axis has length \( L \). It is kept in a magnetic field \( \vec{B} = (2\hat{i} + 3\hat{j} - 4\hat{k}) \) T. The magnitude of the magnetic force acting on the wire is:

• (1) \( 3 I L \)
• (2) \( \sqrt{5} I L \)
• (3) \( 5 I L \)
• (4) \( \sqrt{3} I L \)

The resistance of platinum wire at 0°C is \(2,\Omega\) and \(6.82,\Omega\) at 80°C. The temperature coefficient of resistance of the wire is:

• (1) \( 3 \times 10^{-4} \, °C^{-1} \)
• (2) \( 3 \times 10^{-3} \, °C^{-1} \)
• (3) \( 3 \times 10^{-2} \, °C^{-1} \)
• (4) \( 3 \times 10^{-1} \, °C^{-1} \)

A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity of 4 m/s. The ball strikes the water surface after 4 s. The height of the bridge above water surface is (Take \( g = 10 \, m/s^2 \)):

• (1) 56 m
• (2) 60 m
• (3) 64 m
• (4) 68 m

Chemistry : Section-A

Question 51:

The given compound



is an example of:

• (1) benzylic halide
• (2) aryl halide
• (3) allylic halide
• (4) vinylic halide

Intermolecular forces are forces of attraction and repulsion between interacting particles that will include:

• (1) B, C, D, E are correct.
• (2) A, B, C, D are correct.
• (3) A, B, C, E are correct.
• (4) A, C, D, E are correct.

Which amongst the following molecules on polymerization produces neoprene?

• (1) \( H_2C = CH - CH = CH_2 \)
• (2) \( H_2C = C(Cl) - CH = CH_2 \)
• (3) \( H_2C = CH - C = CH \)
• (4) \( H_2C = C(CH_3) - CH = CH_2 \)

Identify product (A) in the following reaction:

• (1)
• (2)
• (3)
• (4)

Correct Answer: (1)
View Solution

The correct order of energies of molecular orbitals of \( N_2 \) molecule is:

• (1) \( \sigma 1s < \sigma^* 1s < \sigma 2s < \sigma^* 2s < \pi 2p_x = \pi 2p_y < \pi^* 2p_x = \pi^* 2p_y < \sigma^* 2p_z \)
• (2) \( \sigma 1s < \sigma^* 1s < \sigma 2s < \sigma^* 2s < \pi 2p_x = \pi 2p_y < \pi^* 2p_x = \pi^* 2p_y < \sigma 2p_z \)
• (3) \( \sigma 1s < \sigma^* 1s < \sigma 2s < \sigma^* 2s < \pi 2p_x = \pi 2p_y < \pi^* 2p_x = \pi^* 2p_y < \sigma^* 2p_z \)
• (4) \( \sigma 1s < \sigma^* 1s < \sigma 2s < \sigma^* 2s < \pi 2p_x = \pi 2p_y < \pi^* 2p_x = \pi^* 2p_y < \sigma^* 2p_z \)

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reason R: The deep blue solution is due to the formation of amide.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true but R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

Homoleptic complex from the following complexes is:

• (1) Potassium trioxalatoaluminate (III)
• (2) Diamminechloridonitrito - N - platinum (II)
• (3) Pentaamminecarbonatocobalt (III) chloride
• (4) Triamminetriaquachromium (III) chloride

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: In equation \( \Delta G = -nFE_{cell} \), the value of \( \Delta G \) depends on \( n \).

Reason R: \( E_{cell} \) is an intensive property and \( \Delta G \) is an extensive property.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true and R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

Complete the following reaction:

• (1)
• (2)
• (3)
• (4)

Correct Answer: (2)
View Solution

The element expected to form the largest ion to achieve the nearest noble gas configuration is:

• (1) O
• (2) F
• (3) N
• (4) Na

Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in the presence of calcium oxide is:

• (1) 16
• (2) 32
• (3) 30
• (4) 18

Taking stability as the factor, which one of the following represents the correct relationship?

• (1) \( TiCl_3 > TiCl_2 \)
• (2) \( InI_3 > InI \)
• (3) \( AlCl_3 > AlCl_2 \)
• (4) \( TlI > TlI_3 \)

Which of the following reactions will NOT give a primary amine as the product?

• (1) \( CH_3 CONH_2 \xrightarrow{Br_2 / KOH} \) Product
• (2) \( CH_3 CN \xrightarrow{LiAlH_4 , H_3O^+} \) Product
• (3) \( CH_3 NC \xrightarrow{LiAlH_4, H_3O^+} \) Product
• (4) \( CH_3 CONH_2 \xrightarrow{LiAlH_4, H_3O^+} \) Product

Amongst the given options, which of the following molecules/ions acts as a Lewis acid?

• (1) NH\(_3\)
• (2) H\(_2\)O
• (3) BF\(_3\)
• (4) OH\(^-\)

Consider the following reaction and identify the product (P): \[ CH_3CH(CH_3) - CH(OH)CH_3 \xrightarrow{HBr} Product (P) \]
3-Methylbutan-2-ol

• (1) \( CH_3 - C(Br)(CH_3) - CH_2 CH_3 \)
• (2) \( CH_3 - CH = CH CH_3 \)
• (3) \( CH_3 - CH(CH_3) - CH(Br) - CH_3 \)
• (4) \( CH_3 - CH(CH_3)(CH_3) - CH_2 (Br) \)

Identify the product in the following reaction:

• (1)
• (2)
• (3)
• (4)

Correct Answer: (4)
View Solution

The number of \( \sigma \) bonds, \( \pi \) bonds and lone pair of electrons in pyridine, respectively are:

• (1) 11, 2, 0
• (2) 12, 3, 0
• (3) 11, 3, 1
• (4) 12, 2, 1

Which one is an example of heterogeneous catalysis?

• (1) Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
• (2) Hydrolysis of sugar catalysed by H\(^+\) ions.
• (3) Decomposition of ozone in presence of nitrogen monoxide.
• (4) Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.

For a certain reaction, the rate = \( k[A]^2[B] \), when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would:

• (1) decrease by a factor of nine.
• (2) increase by a factor of six.
• (3) increase by a factor of nine.
• (4) increase by a factor of three.

Which amongst the following options is correct graphical representation of Boyle's Law?

• (1)
• (2)
• (3)
• (4)

Correct Answer: (3)
View Solution

The right option for the mass of CO\(_2\) produced by heating 20g of 20% pure limestone is (Atomic mass of Ca = 40):
\[ CaCO_3 \xrightarrow{1200 \, K} CaO + CO_2 \]

• (1) 1.12 g
• (2) 1.76 g
• (3) 2.64 g
• (4) 1.32 g

The relation between \( n_m \) (where \( n_m \) is the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is:

• (1) \( l = \frac{n_m - 1}{2} \)
• (2) \( l = 2n_m + 1 \)
• (3) \( n_m = 2l^2 + 1 \)
• (4) \( n_m = l + 2 \)

The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm\(^{-1}\) cm\(^{-1}\) and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of the cell constant is:

• (1) 1.34 cm\(^{-1}\)
• (2) 3.28 cm\(^{-1}\)
• (3) 1.26 cm\(^{-1}\)
• (4) 3.34 cm\(^{-1}\)

Given below are two statements:

Statement I: A unit formed by the attachment of a base to the 1' position of sugar is known as nucleoside.

Statement II: When nucleoside is linked to phosphorous acid at the 5'-position of sugar moiety, we get nucleotide.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: Helium is used to dilute oxygen in diving apparatus.

Reason R: Helium has high solubility in O\(_2\).

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true and R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

The stability of Cu\(^{2+}\) is more than Cu\(^+\) salts in aqueous solution due to:

• (1) first ionisation enthalpy.
• (2) enthalpy of atomization.
• (3) hydration energy.
• (4) second ionisation enthalpy.

Match List-I with List-II


Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-IV, B-I, C-II, D-III
• (3) A-III, B-I, C-IV, D-II
• (4) A-I, B-IV, C-I, D-II

A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy \( \frac{1}{3} \) of tetrahedral voids. If the formula of the compound is \( A_xB_y \), then the value of \( x + y \) is in option:

• (1) 5
• (2) 4
• (3) 3
• (4) 2

Amongst the following, the total number of species NOT having eight electrons around the central atom in its outermost shell is: \[ NH_3, AlCl_3, BeCl_2, CCl_4, PCl_5 \]

• (1) 5
• (2) 2
• (3) 4
• (4) 1

Which of the following statements are NOT correct?

A. Hydrogen is used to reduce heavy metal oxides to metals.

B. Heavy water is used to study reaction mechanisms.

C. Hydrogen is used to make saturated fats from oils.

D. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element.

E. Hydrogen reduces oxides of metals that are more active than iron.

Choose the most appropriate answer from the options given below:

• (1) B, C, D, E only
• (2) B, D only
• (3) D, E only
• (4) A, B, C only

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: A reaction can have zero activation energy.
Reason R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to the threshold value, is called activation energy.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true and R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

• (1) Chlordiazepoxide
• (2) Meprobamate
• (3) Valium
• (4) Veronal

Select the correct statements from the following:

A. Atoms of all elements are composed of two fundamental particles.

B. The mass of the electron is \( 9.10939 \times 10^{-31} \) kg.

C. All the isotopes of a given element show the same chemical properties.

D. Protons and electrons are collectively known as nucleons.

E. Dalton's atomic theory regarded the atom as the ultimate particle of matter.

Choose the correct answer from the options given below:

• (1) A, B and C only
• (2) C, D and E only
• (3) A and E only
• (4) B, C and E only

Which one of the following statements is correct?

• (1) The daily requirement of Mg and Ca in the human body is estimated to be 0.2 - 0.3 g.
• (2) All enzymes that utilise ATP in phosphate transfer require Ca as the cofactor.
• (3) The bone in human body is an inert and unchanging substance.
• (4) Mg plays roles in neuromuscular function and interneuronal transmission.

In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe\(^3+\) due to the formation of:

• (1) \( Fe_4[Fe(CN)_6] \cdot x H_2O \)
• (2) NaSCN
• (3) \( [Fe(CN)_5 NOS]^{4-} \)
• (4) \( [Fe(SCN)]_2^{2+} \)

Chemistry : Section-B

Question 86:

Which amongst the following will be most readily dehydrated under acidic conditions?

• (1)
• (2)
• (3)
• (4)

Correct Answer: (3)

View Solution

The compound shown in option (3) is most likely to undergo dehydration under acidic conditions because of its ability to form a stable carbocation intermediate or an alkene that is thermodynamically favored. Dehydration is a common reaction for alcohols, especially when they have a hydroxyl group attached to a carbon adjacent to a double bond or can form a stable carbocation. Quick Tip: In dehydration reactions, alcohols that can form stable carbocations or conjugated alkenes are more likely to undergo dehydration.

Identify the final product [D] obtained in the following sequence of reactions:

• (1)
• (2)
• (3) C_4H_{10}
• (4) HC\equiv C\(^-\)Na\(^+\)

Correct Answer: (1)
View Solution

On balancing the given redox reaction, \[ a Cr_2O_7^{2-} + b SO_3^{2-} + c H^+ \rightarrow 2a Cr^{3+} + b SO_4^{2-} + \frac{c}{2} H_2O \]
the coefficients \(a\), \(b\) and \(c\) are found to be, respectively -

• (1) 1, 3, 8
• (2) 3, 8, 1
• (3) 1, 8, 3
• (4) 8, 1, 3

Given below are two statements:

Statement I: The nutrient-deficient water bodies lead to eutrophication.

Statement II: Eutrophication leads to a decrease in the level of oxygen in the water bodies.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is correct but Statement II is false.
• (4) Statement I is incorrect but Statement II is true.

Match List - I with List - II:


\begin{tabular{|c|c|
\hline
List - I (Oxoacids) & List - II (Bonds of Sulphur)

\hline
A. Peroxodisulfuric acid & I. Two S-OH, Four S=O

B. Sulphuric acid & II. Two S-OH, One S=O

C. Pyrosulphuric acid & III. Two S-OH, Four S=O, One S-O-S

D. Sulphurous acid & IV. Two S-OH, Two S=O

\hline
\end{tabular


Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-III, B-IV, C-I, D-II
• (3) A-I, B-III, C-IV, D-II
• (4) A-I, B-IV, C-II, D-I

The equilibrium concentrations of the species in the reaction \( A + B \rightleftharpoons C + D \) are 2, 3, and 10 mol L\(^{-1}\), respectively at 300 K. \( \Delta G^\circ \) for the reaction is (R = 2 cal/mol K):

• (1) 1372.60 cal
• (2) -137.26 cal
• (3) 1381.80 cal
• (4) -13.73 cal

Consider the following compounds/species:


i.
ii.
iii.
iv.
v.
vi.
vii.


The number of compounds/species which obey Huckel’s rule is: ........

• (1) 4
• (2) 6
• (3) 2
• (4) 5

Which of the following statements are INCORRECT?

A. All the transition metals except scandium form MO oxides which are ionic.

B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in \( Sc_2O_3 \) to \( Mn_2O_7 \).

C. Basic character increases from \( V_2O_3 \) to \( V_2O_4 \) to \( V_2O_5 \).

D. \( V_2O_4 \) dissolves in acids to give \( VO_3^- \) salts.

E. \( Cr_2O_3 \) is basic but \( Cr_2O_3 \) is amphoteric.

Choose the correct answer from the options given below:

• (1) A and E only
• (2) B and D only
• (3) C and D only
• (4) B and C only

Pumice stone is an example of -

• (1) sol
• (2) gel
• (3) solid sol
• (4) foam

Consider the following reaction:



Identify products A and B.

• (1)
• (2)
• (3)
• (4)

Correct Answer: (3)
View Solution

Which complex compound is most stable?

• (1) \([ Co(NH_3)_4 (H_2O) Br] (NO_3)_2 \)
• (2) \([ Co(NH_3)_6 (NO_3)_3 \)
• (3) \([ CoCl_2 (en)_2 ] NO_3 \)
• (4) \([ Co(NH_3)_6 (SO_4)_3 \)

Identify the major product obtained in the following reaction:

• (1)
• (2)
• (3)
• (4)

Correct Answer: (2)
View Solution

Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?

• (1) \( \Delta H = \Delta U - \Delta nRT \)
• (2) \( \Delta H = \Delta U + \Delta nRT \)
• (3) \( \Delta H = \Delta U - \Delta nRT \)
• (4) \( \Delta H + \Delta U = \Delta nR \)

What fraction of one edge centred octahedral void lies in one unit cell of fcc?

• (1) \( \frac{1}{2} \)
• (2) \( \frac{1}{3} \)
• (3) \( \frac{1}{4} \)
• (4) \( \frac{1}{12} \)

The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is:

• (1) \( Fe_2O_3 + CO \rightarrow FeO + CO_2 \)
• (2) \( FeO + CO \rightarrow Fe + CO_2 \)
• (3) \( C + CO_2 \rightarrow 2 CO \)
• (4) \( CaO + SiO_2 \rightarrow CaSiO_3 \)

Botany : Section-A

Question 101:

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

• (1) Osmosis
• (2) Facilitated Diffusion
• (3) Passive Transport
• (4) Active Transport

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: ATP is used at two steps in glycolysis.

Reason R: First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in the conversion of fructose-6-phosphate into fructose-1,6-diphosphate.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true but R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

Among eukaryotes, replication of DNA takes place in

• (1) M phase
• (2) S phase
• (3) G1 phase
• (4) G2 phase

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: Late wood has fewer xylary elements with narrow vessels.

Reason R: Cambium is less active in winters.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true but R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

The process of appearance of recombination nodules occurs at which sub-stage of prophase I in meiosis?

• (1) Zygotene
• (2) Pachytene
• (3) Diplotene
• (4) Diakinesis

Unequivocal proof that DNA is the genetic material was first proposed by

• (1) Frederick Griffith
• (2) Alfred Hershey and Martha Chase
• (3) Avery, MacLeod, and McCarty
• (4) Wilkins and Franklin

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: The first stage of gametophyte in the life cycle of moss is protonema stage.

Reason R: Protonema develops directly from spores produced in the capsule.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both A and R are correct and R is the correct explanation of A.
• (2) Both A and R are correct but R is NOT the correct explanation of A.
• (3) A is correct but R is not correct.
• (4) A is not correct but R is correct.

In gene gun method used to introduce alien DNA into host cells, microparticles of ........ metal are used.

• (1) Copper
• (2) Zinc
• (3) Tungsten or gold
• (4) Silver

Axile placentation is observed in

• (1) Mustard, Cucumber and Primrose
• (2) China rose, Beans and Lupin
• (3) Tomato, Dianthus and Pea
• (4) China rose, Petunia and Lemon

In the equation \[ GPP - R = NPP \]
GPP is Gross Primary Productivity,
NPP is Net Primary Productivity.
R here is ________.

• (1) Photosynthetically active radiation
• (2) Respiratory quotient
• (3) Respiratory loss
• (4) Reproductive allocation

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as:

• (1) Differentiation
• (2) Dedifferentiation
• (3) Development
• (4) Senescence

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

• (1) Transcription of rRNAs (28S, 18S and 5.8S)
• (2) Transcription of tRNA, 5S rRNA and snRNA
• (3) Transcription of precursor of mRNA
• (4) Transcription of only snRNAs

Upon exposure to UV radiation, DNA stained with ethidium bromide will show:

• (1) Bright red colour
• (2) Bright blue colour
• (3) Bright yellow colour
• (4) Bright orange colour

The thickness of ozone in a column of air in the atmosphere is measured in terms of:

• (1) Dobson units
• (2) Decibels
• (3) Decameter
• (4) Kilobase

Which hormone promotes internode/petiole elongation in deep water rice?

• (1) GA\(_3\)
• (2) Kinetin
• (3) Ethylene
• (4) 2, 4-D

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are:

• (1) Synergids, Primary endosperm nucleus and zygote
• (2) Antipodals, synergids, and primary endosperm nucleus
• (3) Synergids, Zygote and Primary endosperm nucleus
• (4) Synergids, antipodals and Polar nuclei

Cellulose does not form blue color with iodine because

• (1) It is a disaccharide.
• (2) It is a helical molecule.
• (3) It does not contain complex helices and hence cannot hold iodine molecules.
• (4) It breaks down when iodine reacts with it.

Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?

• (1) Habitat loss and fragmentation
• (2) Over exploitation for economic gain
• (3) Alien species invasions
• (4) Co-extinctions

Identify the pair of heterosporous pteridophytes among the following:

• (1) Lycopodium and Selaginella
• (2) Selaginella and Salvinia
• (3) Psilotum and Salvinia
• (4) Equisetum and Salvinia

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae:

• (1) Diadelphous and Dithecous anthers
• (2) Polyadelphous and epipetalous stamens
• (3) Monoadelphous and Monothecous anthers
• (4) Epiphyllous and Dithecous anthers

The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year :

• (1) 1985
• (2) 1992
• (3) 1986
• (4) 2002

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

• (1) RNA
• (2) DNA
• (3) Histones
• (4) Polysaccharides

What is the function of tassels in the corn cob?

• (1) To attract insects
• (2) To trap pollen grains
• (3) To disperse pollen grains
• (4) To protect seeds

Given below are two statements:

Statement I: The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.

Statement II: Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?

• (1) Indole-3-butyric Acid
• (2) Gibberellic Acid
• (3) Zeatin
• (4) Abscisic Acid

Which micronutrient is required for splitting of water molecule during photosynthesis?

• (1) manganese
• (2) molybdenum
• (3) magnesium
• (4) copper

Identify the correct statements:

A. Detrivores perform fragmentation.

B. The humus is further degraded by some microbes during mineralization.

C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.

D. The detritus food chain begins with living organisms.

E. Earthworms break down detritus into smaller particles by a process called catabolism.

Choose the correct answer from the options given below:

• (1) A, B, C only
• (2) B, C, D only
• (3) C, D, E only
• (4) D, E, A only

Which of the following stages of meiosis involves division of centromere?

• (1) Metaphase I
• (2) Metaphase II
• (3) Anaphase II
• (4) Telophase

The reaction center in PS II has an absorption maxima at

• (1) 680 nm
• (2) 700 nm
• (3) 660 nm
• (4) 780 nm

Given below are two statements:

Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.

Statement II: Exarch condition is the most common feature of the root system.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is correct but Statement II is false.
• (4) Statement I is incorrect but Statement II is true.

Frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

• (1) Thomas Hunt Morgan
• (2) Sutton and Boveri
• (3) Alfred Sturtevant
• (4) Henking

The phenomenon of pleiotropism refers to

• (1) Presence of several alleles of a single gene controlling a single crossover.
• (2) Presence of two alleles, each of the two genes controlling a single trait.
• (3) A single gene affecting multiple phenotypic expression.
• (4) More than two genes affecting a single character.

Expressed Sequence Tags (ESTs) refers to

• (1) All genes that are expressed as RNA.
• (2) All genes that are expressed as proteins.
• (3) All genes whether expressed or unexpressed.
• (4) Certain important expressed genes.

How many ATP and NADPH are required for the synthesis of one molecule of Glucose during the Calvin cycle?

• (1) 12 ATP and 12 NADPH
• (2) 18 ATP and 12 NADPH
• (3) 12 ATP and 16 NADPH
• (4) 18 ATP and 16 NADPH

Large, colourful, fragrant flowers with nectar are seen in:

• (1) Insect pollinated plants
• (2) Bird pollinated plants
• (3) Bat pollinated plants
• (4) Wind pollinated plants

Question 136:

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-I, B-II, C-IV, D-I
• (2) A-IV, B-II, C-I, D-III
• (3) A-IV, B-I, C-II, D-III
• (4) A-II, B-IV, C-I, D-III

Which one of the following statements is NOT correct?

• (1) The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.
• (2) Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
• (3) Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
• (4) The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: A flower is defined as a modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R: Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true but R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below:

• (1) B, C, D, A
• (2) C, A, B, D
• (3) C, B, D, A
• (4) B, D, A, C

How many different proteins does the ribosome consist of?

• (1) 80
• (2) 60
• (3) 40
• (4) 20

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-III, B-II, C-I, D-IV
• (2) A-II, B-III, C-IV, D-I
• (3) A-III, B-I, C-IV, D-II
• (4) A-II, B-IV, C-I, D-III

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: In gymnosperms, the pollen grains are released from the microsporangium and carried by air currents.

Reason R: Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true but R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-I, D-III
• (2) A-IV, B-I, C-II, D-III
• (3) A-IV, B-III, C-I, D-II
• (4) A-III, B-I, C-IV, D-II

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

• (1) Succinic dehydrogenase
• (2) Amylase
• (3) Lipase
• (4) Dinitrogenase

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-IV, B-III, C-II, D-I
• (3) A-III, B-I, C-IV, D-II
• (4) A-II, B-I, C-IV, D-III

Which of the following combinations is required for chemiosmosis?

• (1) membrane, proton pump, proton gradient, ATP synthase
• (2) membrane, proton pump, proton gradient, NADP synthase
• (3) proton pump, electron gradient, ATP synthase
• (4) proton pump, electron gradient, NADP synthase

Identify the correct statements:

A. Lenticels are the lens-shaped openings permitting the exchange of gases.

B. Bark formed early in the season is called hard bark.

C. Bark is a technical term that refers to all tissues exterior to vascular cambium.

D. Bark refers to periderm and secondary phloem.

E. Phellogen is single-layered in thickness.

Choose the correct answer from the options given below:

• (1) B, C and E only
• (2) A and D only
• (3) A, B and D only
• (4) B and C only

Which of the following statements are correct about Klinefelter’s Syndrome?

A. This disorder was first described by Langdon Down (1866).

B. Such an individual has overall masculine development. However, the feminine development is also expressed.

C. The affected individual is short statured.

D. Physical, psychomotor, and mental development is retarded.

E. Such individuals are sterile.

Choose the correct answer from the options given below:

• (1) A and B only
• (2) C and D only
• (3) B and E only
• (4) A and E only

Given below are two statements:

Statement I: Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.

Statement II: In general, carnivores are more adversely affected by competition than herbivores.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is correct but Statement II is false.
• (4) Statement I is incorrect but Statement II is true.

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-III, B-IV, C-II, D-I
• (2) A-II, B-IV, C-I, D-III
• (3) A-III, B-I, C-II, D-IV
• (4) A-I, B-IV, C-III, D-II

Zoology : Section-A 

Question 151:

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-III, B-I, C-II, D-IV
• (2) A-II, B-IV, C-I, D-III
• (3) A-I, B-IV, C-II, D-II
• (4) A-II, B-IV, C-III, D-I

Which of the following functions is carried out by cytoskeleton in a cell?

• (1) Nuclear division
• (2) Protein synthesis
• (3) Motility
• (4) Transportation

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-II, B-III, C-IV, D-I
• (3) A-I, B-IV, C-III, D-II
• (4) A-III, B-I, C-IV, D-II

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.

Reason R: Ban on amniocentesis checks increasing menace of female foeticide.

In the light of the above statements,choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true and R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-II, B-III, C-IV, D-I
• (2) A-I, B-III, C-I, D-IV
• (3) A-III, B-II, C-I, D-IV
• (4) A-III, B-II, C-IV, D-I

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-III, B-I, C-IV, D-II
• (2) A-III, B-IV, C-II, D-I
• (3) A-II, B-III, C-I, D-IV
• (4) A-IV, B-II, C-I, D-III

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

• (1) Recombinant DNA Technology
• (2) Serum and Urine analysis
• (3) Polymerase Chain Reaction (PCR) technique
• (4) Enzyme Linked Immuno-Sorbent Assay (ELISA) technique

Match List I with List II with respect to human eye.



Choose the correct answer from the options given below:

• (1) A-III, B-I, C-IV, D-II
• (2) A-IV, B-III, C-II, D-I
• (3) A-I, B-IV, C-III, D-II
• (4) A-II, B-I, C-II, D-IV

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

• (1) Tasmanian wolf, Bobcat, Marsupial mole
• (2) Numbat, Spotted cuscus, Flying phalanger
• (3) Mole, Flying squirrel, Tasmanian tiger cat
• (4) Lemur, Anteater, Wolf

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-III, B-I, C-IV, D-II
• (2) A-IV, B-II, C-I, D-III
• (3) A-III, B-IV, C-I, D-III
• (4) A-I, B-II, C-III, D-IV

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-II, B-III, C-II, D-IV
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-I, C-IV, D-II

Vital capacity of lung is .......

• (1) IRV + ERV
• (2) IRV + ERV + TV + RV
• (3) IRV + ERV + TV - RV
• (4) IRV + ERV + TV

Broad palm with single palm crease is visible in a person suffering from-

• (1) Down’s syndrome
• (2) Turner’s syndrome
• (3) Klinefelter’s syndrome
• (4) Thalassemia

Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

• (1) Genital herpes
• (2) Gonorrhoea
• (3) Hepatitis-B
• (4) HIV Infection

Given below are two statements:

Statement I: Ligaments are dense irregular tissue.

Statement II: Cartilage is dense regular tissue.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

Given below are two statements:

Statement I: A protein is imagined as a line, the left end represented by the first amino acid (C-terminal) and the right end represented by the last amino acid (N-terminal).

Statement II: Adult human hemoglobin consists of 4 subunits (two subunits of \(\alpha\) type and two subunits of \(\beta \)type).

In the light of the above statements,choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

Match List I with List II.



Choose the correct answer from the options given below:

• (1) A-I, B-II, C-III, D-IV
• (2) A-I, B-II, C-IV, D-III
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-III, C-I, D-IV

Which of the following is not a cloning vector?

• (1) BAC
• (2) YAC
• (3) pBR322
• (4) Probe

Which one of the following symbols represents mating between relatives in human pedigree analysis?

• (1)
• (2)
• (3)
• (4)

Correct Answer:
View Solution

Which of the following statements are correct regarding female reproductive cycle?

A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.

B. First menstrual cycle begins at puberty and is called menopause.

C. Lack of menstruation may be indicative of pregnancy.

D. Cyclic menstruation extends between menarche and menopause.

Choose the most appropriate answer from the options given below:

• (1) A and D only
• (2) A and B only
• (3) A, B and C only
• (4) A, C and D only

Match List I with List II:



Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-II, B-IV, C-I, D-I
• (3) A-I, B-IV, C-I, D-III
• (4) A-IV, B-II, C-III, D-I

Given below are two statements:

Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.

Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is correct but Statement II is false.
• (4) Statement I is incorrect but Statement II is true.

Which of the following are NOT considered as the part of endomembrane system?

A. Mitochondria

B. Endoplasmic Reticulum

C. Chloroplasts

D. Golgi complex

E. Peroxisomes

Choose the most appropriate answer from the options given below:

• (1) B and D only
• (2) A, C and E only
• (3) A and D only
• (4) A, D and E only

Which of the following statements is correct?

• (1) Eutrophication refers to increase in domestic sewage and waste water in lakes.
• (2) Biomagnification refers to increase in concentration of the toxicant at five trophic levels.
• (3) Presence of large amount of nutrients in water restricts ‘Algal Bloom’
• (4) Algal Bloom decreases fish mortality

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: Endometrium is necessary for implantation of blastocyst.

Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true but R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

Given below are statements: One is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: Nephrons are of two types: Cortical \& Juxta medullary, based on their relative position in cortex and medulla.

Reason R: Juxta medullary nephrons have short loop of Henle whereas cortical nephrons have longer loop of Henle.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
• (2) Both A and R are true but R is NOT the correct explanation of A.
• (3) A is true but R is false.
• (4) A is false but R is true.

In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

• (1) T H cells
• (2) B-lymphocytes
• (3) Basophils
• (4) Eosinophils

Radial symmetry is NOT found in adults of phylum ____

• (1) Ctenophora
• (2) Hemichordata
• (3) Coelenterata
• (4) Echinodermata

Given below are two statements:

Statement I: RNA mutates at a faster rate.

Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

Match List I with List II.



Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-I
• (2) A-II, B-I, C-IV, D-III
• (3) A-III, B-I, C-IV, D-II
• (4) A-II, B-IV, C-I, D-II

Given below are two statements:

Statement I: Electrostatic precipitator is most widely used in thermal power plants.

Statement II: Electrostatic precipitator in thermal power plant removes ionizing radiations.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Given below are two statements:

Statement I: Low temperature preserves the enzyme in a temporarily inactive state, whereas high temperature destroys enzymatic activity because proteins are denatured by heat.

Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

Match List I with List II.



Choose the correct answer from the options given below:

• (1) A-I, B-II, C-III, D-IV
• (2) A-I, B-II, C-IV, D-III
• (3) A-III, B-II, C-IV, D-II
• (4) A-IV, B-II, C-IV, D-I

Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by:

• (1) Sphincter of Oddi
• (2) Ileum-caecal valve
• (3) Gastro-oesophageal sphincter
• (4) Pyloric sphincter

Given below are two statements:

Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.

Statement II: The cavity of the cervix is called cervical canal which, along with vagina, forms the birth canal.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is correct but Statement II is false.
• (4) Statement I is incorrect but Statement II is true.

Match List I with List II.



Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-II, B-III, C-I, D-IV
• (3) A-III, B-IV, C-I, D-III
• (4) A-II, B-IV, C-III, D-I

The unique mammalian characteristics are:

• (1) hairs, tympanic membrane and mammary glands
• (2) hairs, pinna and mammary glands
• (3) hairs, pinna and indirect development
• (4) pinna, monocondylic skull and mammary glands

Select the correct statements with reference to chordates:

A. Presence of a mid-dorsal, solid and double nerve cord.

B. Presence of closed circulatory system.

C. Presence of paired pharyngeal gill slits.

D. Presence of dorsal heart.

E. Triploblastic pseudocoelomate animals.


Choose the correct answer from the options given below:

• (1) A, C and D only
• (2) B and C only
• (3) B, D and E only
• (4) C, D and E only

Select the correct statements.

A. Tetrad formation is seen during Leptotene.

B. During Anaphase, the centromeres split and chromatids separate.

C. Terminalization takes place during Pachytene.

D. Nucleolus, Golgi complex and ER are reforming during Telophase.

E. Crossing over takes place between sister chromatids of homologous chromosomes.

Choose the correct answer from the options given below:

• (1) A and C only
• (2) B and D only
• (3) A, C and E only
• (4) B and E only

The parts of human brain that help in regulation of sexual behavior, expression of excitement, pleasure, rage etc. are:

• (1) Limbic system \& hypothalamus
• (2) Corpora quadrigemina \& hippocampus
• (3) Brain stem \& epithalamus
• (4) Corpus callosum and thalamus

Which one of the following is NOT an advantage of inbreeding?

• (1) It decreases homozygosity.
• (2) It exposes harmful recessive genes that are eliminated by selection.
• (3) Elimination of less desirable genes and accumulation of superior genes takes place due to it.
• (4) It decreases the productivity of inbred population, after continuous inbreeding.

Match List I with List II.



Choose the correct answer from the options given below:

• (1) A-I, B-II, C-IV, D-III
• (2) A-I, B-III, C-I, D-IV
• (3) A-I, B-IV, C-I, D-III
• (4) A-II, B-IV, C-I, D-I

Which of the following statements are correct?

A. An excessive loss of body fluid from the body switches off osmoreceptors.

B. ADH facilitates water reabsorption to prevent diuresis.

C. ANF causes vasodilation.

D. ADH causes an increase in blood pressure.

E. ADH is responsible for a decrease in GFR.

Choose the correct answer from the options given below:

• (1) A and B only
• (2) B, C and D only
• (3) A, B and E only
• (4) C, D and E only

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows:

5’ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3’

• (1) 5’ UAGCUAGCUAGCUAGCUA GCUAGC UAGC 3’
• (2) 3’ UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5’
• (3) 5’ ATCGATCGATCGATCGATCG ATCGATCG 3’
• (4) 3’ ATCGATCGATCGATCGATCG ATCGATCG 5’

Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

• (1) Dark brown body colour and anal cerci
• (2) Presence of anal styles
• (3) Presence of sclerites
• (4) Presence of anal cerci

Which of the following statements are correct?

A. Basophils are the most abundant cells of the total WBCs.

B. Basophils secrete histamine, serotonin, and heparin.

C. Basophils are involved in inflammatory response.

D. Basophils have kidney-shaped nucleus.

E. Basophils are agranulocytes.

Choose the correct answer from the options given below:

• (1) D and E only
• (2) C and E only
• (3) B and C only
• (4) A and B only

Which of the following statements are correct regarding skeletal muscle?

A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.

B. Sarcoplasmic reticulum of muscle fibre is a storehouse of calcium ions.

C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.

D. M line is considered as functional unit of contraction called sarcomere.

Choose the most appropriate answer from the options given below:

• (1) A, B and C only
• (2) B and C only
• (3) A, C and D only
• (4) C and D only

Given below are two statements:

Statement I: During G0 phase of cell cycle, the cell is metabolically inactive.

Statement II: The centrosome undergoes duplication during S phase of interphase.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

In cockroach, excretion is brought about by:

A. Phallic gland

B. Urecose gland

C. Nephrocytes

D. Fat body

E. Collateral glands

Choose the correct answer from the options given below:

• (1) A and E only
• (2) A, B and E only
• (3) B, C and D only
• (4) B and D only

Which of the following are NOT under the control of thyroid hormone?

A. Maintenance of water and electrolyte balance

B. Regulation of basal metabolic rate

C. Normal rhythm of sleep-wake cycle

D. Development of immune system

E. Support the process of RBCs formation

Choose the correct answer from the options given below:

• (1) A and D only
• (2) B and C only
• (3) C and D only
• (4) D and E only