NEET 2023 Question Paper with Answers and Solutions PDF F6 in English

In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 \( \mu \)F and resistance R is 100 \( \Omega \). The frequency at which resonance occurs is :

1. 15.9 kHz
2. 1.59 rad/s
3. 1.59 kHz
4. 15.9 rad/s

The magnitude and direction of the current in the following circuit is :

1. 0.5 A from A to B through E
2. 5/9 A from A to B through E
3. 1.5 A from B to A through E
4. 0.2 A from B to A through E

If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by :

1. 50 Ω
2. 100 Ω
3. 400 Ω
4. 200 Ω

The temperature of a gas is -50\(^\circ\) C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?

1. 3295◦ C
2. 3097 K
3. 223 K
4. 669◦ C

The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :

A Carnot engine has an efficiency of 50% when its source is at a temperature 327\(^\circ\) C. The temperature of the sink is :

A bullet is fired from a gun at the speed of 280 m s\(^{-1}\) in the direction 30\(^\circ\) above the horizontal. The maximum height attained by the bullet is (g = 9.8 m s\(^{-2}\), sin 30\(^\circ\) = 0.5) :

An electric dipole is placed at an angle of 30\(^\circ\) with an electric field of intensity 2\( \times \)10\(^5\) N C\(^{-1}\). It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.

Given below are two statements :
Statement I : Photovoltaic devices can convert optical radiation into electricity.
Statement II : Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below :

The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :

The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :

The net magnetic flux through any closed surface is :

The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?

The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to :

A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?

Light travels a distance x in time \( t_1 \) in air and 10x in time \( t_2 \) in another denser medium. What is the critical angle for this medium?

A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be :

For Young's double slit experiment, two statements are given below:
Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below :

The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to \( \frac{1}{16} \)th of its initial value?

The equivalent capacitance of the system shown in the following circuit is :

\includegraphics{20.png

Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) \( \Omega \). The colour of third band must be :

An ac source is connected to a capacitor C. Due to decrease in its operating frequency :

A vehicle travels half the distance with speed \( v \) and the remaining half the distance with speed 2\( v \). Its average speed is :

The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution = 0.03 N m\(^{-1}\))

The venturi-meter works on :

In hydrogen spectrum, the shortest wavelength in the Balmer series is \( \lambda \). The shortest wavelength in the Bracket series is :

The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be :

A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

The magnetic energy stored in an inductor of inductance 4 \( \mu \)H carrying a current of 2 A is :

If \( \oint \mathbf{E} \cdot d\mathbf{S} = 0 \) over a surface, then :

A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :

Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is :

The angular acceleration of a body, moving along the circumference of a circle, is :

In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0 \( \times \) 10\(^{10}\) Hz and amplitude 48 V m\(^{-1}\). Then the amplitude of oscillating magnetic field is : (Speed of light in free space = 3 \( \times \) 10\(^8\) m s\(^{-1}\))

Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be : (G = gravitational constant)

In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?

\includegraphics{36.png

Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s\(^{-2}\)).

A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity \( \frac{3 \pi}{Gd} \) represents :

The x-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t = 2 s is :

For the following logic circuit, the truth table for Y is :



A   B   Y
0   0   0
0   1   1
1   0   1
1   1   1

A   B   Y
0   0   0
0   1   0
1   0   1
1   1   1

A & B & Y
0   0   0
0   1   1
1   0   0
1   1   1

A   B   Y
0   0   0
0   1   0
1   0   1
1   1   0
 

A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s\(^{-1}\). The ball strikes the water surface after 4 s. The height of the bridge above water surface is (Take g = 10 m s\(^{-2}\) :

Two thin lenses of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :

A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic field \( \vec{B} = (2\hat{i} + 3\hat{j} - 4\hat{k}) \) T. The magnitude of the magnetic force acting on the wire is :

A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes \( \frac{u}{n} \). Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :

The resistance of platinum wire at 0\(^\circ\)C is 2 \( \Omega \) and 6.8 \( \Omega \) at 80\(^\circ\)C. The temperature coefficient of resistance of the wire is :

An electric dipole is placed as shown in the figure.

\includegraphics{46.png

The electric potential (in \( 10^2 \) V) at point P due to the dipole is \( (\epsilon_0 \) = permittivity of free space and \( \frac{1}{4 \pi \epsilon_0} = K \))

10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is :

A very long conducting wire is bent in a semi-circular shape from A to B as shown in the figure. The magnetic field at point P for steady current configuration is given by :

\includegraphics{48.png

The radius of inner most orbit of hydrogen atom is \( 5.3 \times 10^{-11} \) m. What is the radius of third allowed orbit of hydrogen atom?

The net impedance of circuit (as shown in figure) will be :

\includegraphics{50.png

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reasons R : The deep blue solution is due to the formation of amide.
In the light of the above statements, choose the correct answer from the options given below :

The conductivity of centimolar solution of KCl at 25\(^\circ\)C is 0.0210 ohm\(^{-1}\) cm\(^{-1}\) and the resistance of the cell containing the solution at 25\(^\circ\)C is 60 ohm. The value of cell constant is -

For a certain reaction, the rate = \( k[A]^2[B] \), when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would

Identify product (A) in the following reaction:

\includegraphics{54.png

Which one is an example of heterogeneous catalysis?

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Helium is used to dilute oxygen in diving apparatus.
Reasons R : Helium has high solubility in \( O_2 \).
In the light of the above statements, choose the correct answer from the options given below :

Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is
NH\(_{3}\), AlCl\(_{3}\), BeCl\(_{2}\), CCl\(_{4}\), PCl\(_{5}\)

The correct order of energies of molecular orbitals of \( N_2 \) molecule, is :

Match List - I with List - II
List - I
A. Coke
B. Diamond
C. Fullerene
D. Graphite
List - II
I. Carbon atoms are sp\(^3\) hybridised.
II. Used as a dry lubricant
III. Used as a reducing agent
IV. Cage like molecules
Choose the correct answer from the options given below:

The number of \( \sigma \) and \( \pi \) bonds and lone pair of electrons in pyridine, respectively are:

The element expected to form largest ion to achieve the nearest noble gas configuration is:

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A reaction can have zero activation energy.
Reasons R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below :

Consider the following reaction and identify the product (P).

\includegraphics{63.png

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : In equation \( \Delta_r G^\ominus = -nFE_{cell}^\ominus \), value of \( \Delta_r G^\ominus \) depends on n.
Reasons R : \( E_{cell}^\ominus \) is an intensive property and \( \Delta_r G^\ominus \) is an extensive property.
In the light of the above statements, choose the correct answer from the options given below :

Which amongst the following options is correct graphical representation of Boyle's Law?


\includegraphics{65.png

In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with \( Fe^{3+} \) due to the formation of -

Identify the product in the following reaction:

\includegraphics{67.png

Select the correct statements from the following:
A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is \( 9.10939 \times 10^{-31} \) kg.
C. All the isotopes of a given element show same chemical properties.
D. Protons and electrons are collectively known as nucleons.
E. Dalton's atomic theory, regarded the atom as an ultimate particle of matter.
Choose the correct answer from the options given below:

A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is \( A_x B_y \), then the value of x + y is in option

Given below are two statements :
Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside
Statement II : When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below :

Which amongst the following molecules on polymerization produces neoprene?

Taking stability as the factor, which one of the following represents correct relationship?

Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

Which of the following statements are NOT correct?
A. Hydrogen is used to reduce heavy metal oxides to metals.
B. Heavy water is used to study reaction mechanism.
C. Hydrogen is used to make saturated fats from oils.
D. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element.
E. Hydrogen reduces oxides of metals that are more active than iron.
Choose the most appropriate answer from the options given below:

Intermolecular forces are forces of attraction and repulsion between interacting particles that will include :
A. dipole - dipole forces.
B. dipole - induced dipole forces.
C. hydrogen bonding.
D. covalent bonding.
E. dispersion forces.
Choose the most appropriate answer from the options given below:

Amongst the given options which of the following molecules / ion acts as a Lewis acid?
(1) \( H_2O \)
(2) \( BF_3 \)
(3) \( OH^- \)
(4) \( NH_3 \)

The right option for the mass of \( CO_2 \) produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40) \(\) CaCO_3 \xrightarrow{1200 K CaO + CO_2 \(\)

The relation between \( n_m \) (\( n_m \) = the number of permissible values of magnetic quantum number (m)) for a given azimuthal quantum number (l), is:

The stability of \( Cu^{2+} \) is more than \( Cu^+ \) in aqueous solution due to -
(1) enthalpy of atomization.
(2) hydration energy.
(3) second ionisation enthalpy.
(4) first ionisation enthalpy.

Which one of the following statements is correct?

Which of the following reactions will NOT give primary amine as the product?

The given compound

\includegraphics{82.png

is an example of
(1) aryl halide (2) allylic halide (3) vinylic halide (4) benzylic halide

Complete the following reaction:


\includegraphics{83.png

Homoleptic complex from the following complexes is :

Weight (g) of potassium ethanoate produced by heating 20 g of 20% pure limestone with sodium ethanoate with sodium hydroxide in presence of calcium oxide is :

Consider the following reaction :

\includegraphics{86.png

Identify products A and B.

Which amongst the following will be most readily dehydrated under acidic conditions ?

\includegraphics{87.png

The equilibrium concentrations of the species in the reaction A + B \( \rightleftharpoons \) C + D are 2, 3, 10 and 6 mol \( L^{-1} \) respectively at 300 K. \( \Delta G^\circ \) for the reaction (R = 2 cal \( K^{-1} \) \( mol^{-1} \)) is
(1) - 137.26 cal
(2) - 1381.80 cal
(3) - 13.73 cal
(4) 1372.60 cal

Given below are two statements :
Statement I : The nutrient deficient water bodies lead to eutrophication.
Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies.
In the light of the above statements, choose the \textbf{correct} answer from the options given below :
(1) Both Statement I and Statement II are false.
(2) Statement I is correct but Statement II is false.
(3) Statement I is incorrect but Statement II is true.
(4) Both Statement I and Statement II are true.

Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
(1) \( \Delta H = \Delta U + \Delta n_g RT \)
(2) \( \Delta H = \Delta U - \Delta nRT \)
(3) \( \Delta H = \Delta U + \Delta nRT \)
(4) \( \Delta H = \Delta U - \Delta n_g RT \)

Match List - I with List - II :
List - I (Oxoacids of Sulphur)
A. Peroxodisulphuric acid
B. Sulphuric acid
C. Pyrosulphuric acid
D. Sulphurous acid
List - II (Bonds)
I. Two S-OH, Four S=O, One O-O
II. Two S-OH, One S=O
III. Two S-OH, Four S=O, One S-O-S
IV. Two S-OH, Two S=O

Choose the correct answer from the options given below :

(1) A-III, B-IV, C-I, D-II
(2) A-I, B-II, C-III, D-IV
(3) A-III, B-II, C-I, D-IV
(4) A-I, B-III, C-II, D-IV

Identify the major product obtained in the following reaction :

\includegraphics{92.png

Pumice stone is an example of -
(1) gel
(2) foam
(3) sol
(4) solid sol

The reaction that does \textbf{NOT} take place in a blast furnace between the temperature range of 900 K to 1500 K during extraction of iron is :
(1) \( FeO + CO \rightarrow Fe + CO_2 \)
(2) \( C + CO_2 \rightarrow 2CO \)
(3) \( CaO + SiO_2 \rightarrow CaSiO_3 \)
(4) \( Fe_2O_3 + CO \rightarrow 2FeO + CO_2 \)

Which of the following statements is \textbf{INCORRECT}?
A. All the transition metals except scandium form MO oxides which are ionic.
B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in \( Sc_2O_3 \) to \( Mn_2O_7 \).
C. Basic character increases from \( V_2O_3 \) to \( V_2O_5 \).
D. \( V_2O_4 \) dissolves in acids to give \( VO_2^{2+} \) salts.
E. CrO is basic but \( Cr_2O_3 \) is amphoteric.
Choose the \textbf{correct} answer from the options given below :
(1) B and D only
(2) B and C only
(3) B and C only
(4) A and E only

Consider the following compounds/species:

\includegraphics{96.png

The number of compounds/species which obey Huckel's rule is

What fraction of one edge centred octahedral void lies in one unit cell of fcc?
(1) \( \frac{1}{3} \)
(2) \( \frac{1}{4} \)
(3) \( \frac{1}{12} \)
(4) \( \frac{1}{2} \)

Which complex compound is most stable?
(1) \( [Co(NH_3)_6](NO_3)_3 \)
(2) \( [CoCl_2(en)_2]NO_3 \)
(3) \( [Co(NH_3)_4]Cl_3 \)
(4) \( [Co(NH_3)_4(H_2O)Br](NO_3)_2 \)

On balancing the given redox reaction, \(\) a Cr_2O_7^{2-(aq) + b SO_3^{2-(aq) + c H^+(aq) \rightarrow 2 Cr^{3+(aq) + b SO_4^{2-(aq) + \frac{c{2 H_2O(l) \(\)
the coefficients a, b and c are found to be, respectively -
(1) 3, 8, 1
(2) 1, 8, 3
(3) 8, 1, 3
(4) 1, 3, 8

Identify the final product [D] obtained in the following sequence of reactions.

\includegraphics{100.png

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
(1) Facilitated Diffusion
(2) Passive Transport
(3) Active Transport
(4) Osmosis

Among 'The Evil Quartet', which one is considered the most important driving cause of extinction of species?
(1) Over exploitation for economic gain
(2) Alien species invasions
(3) Co-extinctions
(4) Habitat loss and fragmentation

Identify the pair of heterosporous pteridophytes among the following :
(1) Selaginella and Salvinia
(2) Psilotum and Salvinia
(3) Equisetum and Selaginella
(4) Lycopodium and Selaginella

Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
(1) Sutton and Boveri
(2) Alfred Sturtevant
(3) Henking
(4) Thomas Hunt Morgan

What is the function of tassels in the corn cob?
(1) To trap pollen grains
(2) To disperse pollen grains
(3) To protect seeds
(4) To attract insects

Identify the correct statements :
A. Detritivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the \textbf{correct} answer from the options given below :
(1) B, C, D only
(2) C, D, E only
(3) D, E, A only
(4) A, B, C only

Given below are two statements :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the \textbf{correct} answer from the options given below :
(1) Both A and R are true but R is NOT the correct explanation of A.
(2) A is true but R is false.
(3) A is false but R is true.
(4) Both A and R are true and R is the correct explanation of A.

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
(1) Pachytene
(2) Diplotene
(3) Diakinesis
(4) Zygotene

Which of the following centromere?
(1) Metaphase II
(2) Anaphase II
(3) Telophase II
(4) Metaphase I

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
(1) DNA
(2) Histones
(3) Polysaccharides
(4) RNA

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
(1) Polyadelphous and epipetalous stamens
(2) Monoadelphous and Monothecous anthers
(3) Epiphyllous and Dithecous anthers
(4) Diadelphous and Dithecous anthers

Large, colourful, fragrant flowers with nectar are seen in :
(1) bird pollinated plants
(2) bat pollinated plants
(3) wind pollinated plants
(4) insect pollinated plants

Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
(1) Gibberellic Acid
(2) Zeatin
(3) Abscisic Acid
(4) Indole-3-butyric Acid

Axile placentation is observed in
(1) China rose, Beans and Lupin
(2) Tomato, Dianthus and Pea
(3) China rose, Petunia and Lemon
(4) Mustard, Cucumber and Primrose

Among eukaryotes, replication of DNA takes place in -
(1) S phase
(2) \( G_1 \) phase
(3) \( G_2 \) phase
(4) M phase

How many ATP and NADPH\(_2\) are required for the synthesis of one molecule of Glucose during Calvin cycle?
(1) 18 ATP and 12 NADPH\(_2\)
(2) 12 ATP and 16 NADPH\(_2\)
(3) 18 ATP and 16 NADPH\(_2\)
(4) 12 ATP and 12 NADPH\(_2\)

In gene gun method used to introduce alien DNA into host cells, microparticles of \rule{2cm}{0.15mm} metal are used.

The thickness of ozone in a column of air in the atmosphere is measured in terms of :
(1) Decibels
(2) Decameter
(3) Kilobase
(4) Dobson units

Unequivocal proof that DNA is the genetic material was first proposed by
(1) Alfred Hershey and Martha Chase
(2) Avery, MacLeod and McCarty
(3) Wilkins and Franklin
(4) Frederick Griffith

Unequivocal proof that DNA is the genetic material was first proposed by
(1) Alfred Hershey and Martha Chase
(2) Avery, MacLeod and McCarty
(3) Wilkins and Franklin
(4) Frederick Griffith

In the equation \(\) GPP - R = NPP \(\)
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Which micronutrient is required for splitting of water molecule during photosynthesis?

In angiosperms, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

The phenomenon of pleiotropism refers to

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :

Cellulose does not form blue colour with iodine because

Which hormone promotes internode/petiole elongation in deep water rice?

Expressed Sequence Tags (ESTs) refers to :

Given below are two statements :
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :

The reaction centre in PS II has an absorption maxima at

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below :

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as :

Given below are two statements :
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below :

Identify the correct statements :
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options given below :

Match List I with List II :
List I
A. Cohesion
B. Adhesion
C. Surface tension
D. Guttation
List II
I. More attraction in liquid phase
II. Mutual attraction among water molecules
III. Water loss in liquid phase
IV. Attraction towards polar surfaces
Choose the correct answer from the options given below :

Match List I with List II :
List I
A. \( M \) Phase
B. \( G_2 \) Phase
C. Quiescent stage
D. \( G_1 \) Phase
List II
I. Proteins are synthesized
II. Inactive phase
III. Interval between mitosis and initiation of DNA replication
IV. Equational division
Choose the correct answer from the options given below :

Which of the following statements are correct about Klinefelter's Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below :

Given below are two statements :
Statement I : Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below :

How many different proteins does the ribosome consist of?

Which of the following combination is required for chemiosmosis?

Which one of the following statements is NOT correct?

Match List I with List II :
List I (Interaction)
A. Mutualism
B. Commensalism
C. Amensalism
D. Parasitism
List II (Species A and B)
I. \( + \)(A), \( + \)(B)
II. \( + \)(A), \( 0 \)(B)
III. \( - \)(A), \( 0 \)(B)
IV. \( + \)(A), \( - \)(B)
Choose the correct answer from the options given below :

Main steps in the formation of Recombinant DNA are given in a correct sequence. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below :

Match List I with List II :
List I
A. Iron
B. Zinc
C. Boron
D. Molybdenum
List II
I. Synthesis of auxin
II. Component of nitrate reductase
III. Activator of catalase
IV. Cell elongation and differentiation
Choose the correct answer from the options given below :

Match List I with List II :
List I
A. Oxidative decarboxylation
B. Glycolysis
C. Oxidative phosphorylation
D. Tricarboxylic acid cycle
List II
I. Citrate synthase
II. Pyruvate dehydrogenase
III. Electron transport system
IV. EMP pathway
Choose the correct answer from the options given below :

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below :

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below :

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

Given below are two statements :
Statement I : A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal)
Statement II : Adult human haemoglobin, consists of 4 subunits (two subunits of \( \alpha \) type and two subunits of \( \beta \) type.)
In the light of the above statements, choose the correct answer from the options given below :

Radial symmetry is NOT found in adults of phylum \rule{2cm}{0.15mm}.

Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below :

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below :

Match List I with List II with respect to human eye.
List I
A. Fovea
B. Iris
C. Blind spot
D. Sclera
List II
I. Visible coloured portion of eye that regulates diameter of pupil.
II. External layer of eye formed of dense connective tissue.
III. Point of greatest visual acuity or resolution.
IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent.
Choose the correct answer from the options given below :

Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below :

Broad palm with single palm crease is visible in a person suffering from-

Match List I with List II :
List I
A. P-wave
B. Q-wave
C. QRS complex
D. T-wave
List II
I. Beginning of systole
II. Repolarisation of ventricles
III. Depolarisation of atria
IV. Depolarisation of ventricles
Choose the correct answer from the options given below :

Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

Match List I with List II :
List I (Cells)
A. Peptic cells
B. Goblet cells
C. Oxyntic cells
D. Hepatic cells
List II (Secretion)
I. Mucus
II. Bile juice
III. Proenzyme pepsinogen
IV. HCl and intrinsic factor for absorption of vitamin \( B_{12} \)
Choose the correct answer from the options given below :

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Endometrium is necessary for implantation of blastocyst.
Reason R : In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below :

Which of the following is NOT a cloning vector?

Match List I with List II :
List I
A. Taenia
B. Paramoecium
C. Periplaneta
D. Pheretima
List II
I. Nephridia
II. Contractile vacuole
III. Flame cells
IV. Ureose gland
Choose the correct answer from the options given below :

Given below are two statements :
Statement I : Ligaments are dense irregular connective tissue.
Statement II : Cartilage is dense regular connective tissue.
In the light of the above statements, choose the correct answer from the options given below :

Which of the following functions is carried out by cytoskeleton in a cell?

Match List I with List II :
List I
A. Gene 'i'
B. Gene 'y'
C. Gene 'a'
D. Gene 'z'
List II
I. \( \beta \)-galactosidase
II. Transacetylase
III. Permease
IV. Repressor protein
Choose the correct answer from the options given below :

Which of the following statements is correct?

Which one of the following symbols represents mating between relatives in human pedigree analysis?

\includegraphics{168.png

Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-

Which one of the following techniques does NOT serve the purpose of early diagnosis of a disease for its early treatment?

Given below are two statements:
Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:

Match List I with List II.
List I (Type of Joint)
A. Cartilaginous Joint
B. Ball and Socket Joint
C. Fibrous Joint
D. Saddle Joint
List II (Found between)
I. Between flat skull bones
II. Between adjacent vertebrae in vertebral column
III. Between carpal and metacarpal of thumb
IV. Between Humerus and Pectoral girdle
Choose the correct answer from the options given below:

Given below are two statements:
Statement I : Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II : The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the correct answer from the options given below:

In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

Vital capacity of lung is

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

Match List I with List II.
List I
A. CCK
B. GIP
C. ANF
D. ADH
List II
I. Kidney
II. Heart
III. Gastric gland
IV. Pancreas
Choose the correct answer from the options given below:

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R : Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements:
Statement I : RNA mutates at a faster rate.
Statement II : Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:

Match List I with List II.
List I
A. Vasectomy
B. Coitus interruptus
C. Cervical caps
D. Saheli
List II
I. Oral method
II. Barrier method
III. Surgical method
IV. Natural method
Choose the correct answer from the options given below:

Given below are two statements:
Statement I : Electrostatic precipitator is most widely used in thermal power plant.
Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations
In the light of the above statements, choose the most appropriate answer from the options given below:

Given below are two statements:
Statement I : In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II : In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:

Match List I with List II.
List I
A. Ringworm
B. Filariasis
C. Malaria
D. Pneumonia
List II
I. Haemophilus influenzae
II. Trichophyton
III. Wuchereria bancrofti
IV. Plasmodium vivax
Choose the correct answer from the options given below:

Match List I (Interacting species) with List II (Name of Interaction)
List I (Interacting species)
A. A Leopard and a Lion in a forest/grassland
B. A Cuckoo laying egg in a Crow's nest
C. Fungi and root of a higher plant in Mycorrhizae
D. A cattle egret and a Cattle in a field
List II (Name of Interaction)
I. Competition
II. Brood parasitism
III. Mutualism
IV. Commensalism
Choose the correct answer from the options given below:

Which of the following statements are correct ?
A. Basophils are most abundant cells of the total WBC's
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
Choose the correct answer from the options given below:

Match List I with List II.
List I
A. Mast cells
B. Inner surface of bronchiole
C. Blood
D. Tubular parts of nephron
List II
I. Ciliated epithelium
II. Areolar connective tissue
III. Cuboidal epithelium
IV. Specialised connective tissue
Choose the correct answer from the options given below:

Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosomes.
Choose the correct answer from the options given below:

In cockroach, excretion is brought about by-

Choose the correct answer from the options given below:

Given below are two statements:
Statement I : During \( G_0 \) phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:

Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system.
C. Presence of paired pharyngeal gillslits.
D. Presence of dorsal heart.
E. Triploblastic pseudocoelomate animals.
Choose the correct answer from the options given below:

Match List I with List II.
List I
A. Logistic growth
B. Exponential growth
C. Expanding age pyramid
D. Stable age pyramid
List II
I. Unlimited resource availability condition
II. Limited resource availability condition
III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
IV. The percent individuals of pre-reproductive, reproductive and reproductive age group are same
Choose the correct answer from the options given below:

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?

Which of the following is characteristic feature of cockroach regarding sexual dimorphism ?

Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:

The unique mammalian characteristics are:

Which one of the following is NOT an advantage of inbreeding?

The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :

Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmoreceptors.
B. ADH facilitates water reabsorption to prevent diuresis.
C. ANF causes vasodilation.
D. ADH causes increase in blood pressure.
E. ADH is responsible for decrease in GFR.
Choose the correct answer from the options given below:

Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of R.B.Cs formation
Choose the correct answer from the options given below: