NEET 2024 Question paper with answer key pdf Q2 is available for download. NEET 2024 Q2 question paper has been conducted by the NTA on May 5, 2024, in pen-paper mode. NEET 2024 question paper code Q2 consists of 200 MCQs- 180 to be attempted in 200 minutes. Each of the 4 subjects (Zoology, Botany, Chemistry, Physics) in NEET Q2 question paper 2023 have 50 MCQs (45 to be attempted). You can download NEET 2024 question paper with answer key with solutions PDF for Q2 using the links given below. 

Related Links:

NEET 2024 Question Paper with Answer Key PDF Q2 in English

NEET 2024 Question Paper with Answer Key download iconDownload Check Solutions

NEET 2024 Question Paper With Solution 

SECTION –A

PHYSICS 

Question 1:

Given below are two statements:

Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.

Statement II: Atoms of each element are stable and emit their characteristic spectrum.

Choose the most appropriate answer from the options given below:

  • (1) Both Statement I and Statement II are correct
  • (2) Both Statement I and Statement II are incorrect
  • (3) Statement I is correct but Statement II is incorrect
  • (4) Statement I is incorrect but Statement II is correct

Correct Answer: (3) Statement I is correct but Statement II is incorrect

View Solution:

Question 2:
If x = 5 sin(πt + π/3) represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are:

  • (1) 5 cm, 2 s
  • (2) 5 m, 2 s
  • (3) 5 cm, 1 s
  • (4) 5 m, 1 s

Correct Answer: (2) 5 m, 2 s
View Solution:


Question 3:
A bob is whirled in a horizontal plane by means of a string with an initial speed of ω rpm. The tension in the string is T. If the speed becomes 2ω while keeping the same radius, the tension in the string becomes:

  • (1) T
  • (2) 4T
  • (3) T/4
  • (4) √2 T

Correct Answer: (2) 4T
View Solution:

 


Question 4:
In an ideal transformer, the turns ratio is N_P/N_S = 1/2. The ratio V_S : V_P is equal to (the symbols carry their usual meaning):

  • (1) 1 : 2
  • (2) 2 : 1
  • (3) 1 : 1
  • (4) 1 : 4

Correct Answer: (2) 2 : 1
View Solution:


Question 5:
A logic circuit provides the output Y as per the following truth table:

| A | B | Y |
|---|---|---|
| 0 | 0 | 1 |
| 0 | 1 | 0 |
| 1 | 0 | 1 |
| 1 | 1 | 0 |

The expression for the output Y is:

  • (1) A · B + ¬A
  • (2) A · ¬B + ¬A
  • (3) ¬B
  • (4) B

Correct Answer: (3) ¬B
View Solution:


Question 6:
The graph below shows the variation of 1/λ² and its kinetic energy E, where λ is the de Broglie wavelength of a free particle:

Choose the correct graph:
Q6

  • (1)
  • (2)
  • (3)
  • (4)

Correct Answer: (4)
View Solution:


Question 7:
The output (Y) of the given logic gate is similar to the output of an/a:

Logic Gate Diagram

  • (1) NAND gate
  • (2) NOR gate
  • (3) OR gate
  • (4) AND gate

Correct Answer: (4) AND gate
View Solution:


Question 8:
In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is 9.8 × 10⁻⁶ kg·m². If the magnitude of the magnetic moment of the needle is x × 10⁻⁵ Am², then the value of x is:

Magnetic Needle Diagram

  • (1) 5π²
  • (2) 128π²
  • (3) 50π²
  • (4) 1280π²

Correct Answer: (4) 1280π²
View Solution:


Question 9:
A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:

Thermodynamic Cycle Diagram

  • (1) Zero
  • (2) 30 J
  • (3) -90 J
  • (4) -60 J

Correct Answer: (1) Zero
View Solution:


Question 10:
In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

Magnet and Solenoid Diagram

  • (1) AB and DC
  • (2) BA and CD
  • (3) AB and CD
  • (4) BA and DC

Correct Answer: (1) AB and DC
View Solution:


Question 11:
An unpolarised light beam strikes a glass surface at Brewster's angle. Then:

  • (1) The reflected light will be partially polarised.
  • (2) The refracted light will be completely polarised.
  • (3) Both the reflected and refracted light will be completely polarised.
  • (4) The reflected light will be completely polarised but the refracted light will be partially polarised.

Correct Answer: (4) The reflected light will be completely polarised but the refracted light will be partially polarised.
View Solution:


Question 12:
A wire of length ‘l’ and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

  • (1) 26 Ω
  • (2) 52 Ω
  • (3) 55 Ω
  • (4) 60 Ω

Correct Answer: (2) 52 Ω
View Solution:


Question 13:
A horizontal force of 10 N is applied to a block A as shown in the figure. The masses of blocks A and B are 2 kg and 3 kg, respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is:

Force and Blocks Diagram

  • (1) Zero
  • (2) 4 N
  • (3) 6 N
  • (4) 10 N

Correct Answer: (3) 6 N
View Solution:


Question 14:
Two bodies A and B of same mass undergo completely inelastic one-dimensional collision. The body A moves with velocity v1 while body B is at rest before the collision. The velocity of the system after the collision is v2. The ratio v1 : v2 is:

  • (1) 1 : 2
  • (2) 2 : 1
  • (3) 4 : 1
  • (4) 1 : 4

Correct Answer: (2) 2 : 1
View Solution:


Question 15:
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole moment vector P of magnitude 4 × 10⁻⁶ C m, is ±9 × 10³ V. (Take 1 / (4πϵ₀) = 9 × 10⁹ SI units) Reason R: V = ± 2 / (4πϵ₀) * P / r² where r is the distance of any axial point, situated at 2 m from the centre of the dipole.

  • (1) Both A and R are true and R is the correct explanation of A.
  • (2) Both A and R are true and R is NOT the correct explanation of A.
  • (3) A is true but R is false.
  • (4) A is false but R is true.

Correct Answer: (3) A is true but R is false.
View Solution:


Question 16:
Match List-I with List-II.

List-I     List-II
(Spectral Lines of Hydrogen for transitions from)     (Wavelengths (nm))
A. n2 = 3 to n1 = 2     I. 410.2
B. n2 = 4 to n1 = 2     II. 434.1
C. n2 = 5 to n1 = 2     III. 656.3
D. n2 = 6 to n1 = 2     IV. 486.1

  • (1) A-II, B-I, C-IV, D-III
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-IV, B-III, C-I, D-II
  • (4) A-I, B-II, C-III, D-IV

Correct Answer: (2)
View Solution:


Question 17:
In a vernier callipers, (N + 1) divisions of the vernier scale coincide with N divisions of the main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:

  • (1) \( \frac{1}{10N} \)
  • (2) \( \frac{1}{100(N + 1)} \)
  • (3) \( \frac{100}{N} \)
  • (4) \( 10(N + 1) \)

Correct Answer: (2) \( \frac{1}{100(N + 1)} \)
View Solution:


Question 18:
 A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown in the figure is:

Spherical Shell Diagram

  • (1) \( 3 \times 10^5 \)
  • (2) \( 1 \times 10^5 \)
  • (3) \( 0.5 \times 10^5 \)
  • (4) Zero

Correct Answer: (4) Zero
View Solution:


Question 19:
whose emf is 10 V and internal resistance 1 Ω, when connected through an external resistance of 4 Ω as shown in the figure, is:

Q19

  • (1) 4 V
  • (2) 6 V
  • (3) 8 V
  • (4) 10 V

Correct Answer: (3) 8 V
View Solution:


Question 20:
If c is the velocity of light in free space, the correct statements about photon among the following are:

A. The energy of a photon is E = hν.
B. The velocity of a photon is c.
C. The momentum of a photon is p = h / (νc).
D. In a photon-electron collision, both total energy and total momentum are conserved.
E. Photon possesses positive charge.

  • (1) A and B only
  • (2) A, B, C and D only
  • (3) A, C and D only
  • (4) A, B, D and E only

Correct Answer: (2) A, B, C and D only
View Solution:


Question 21:
A particle moving with uniform speed in a circular path maintains:

  • (1) Constant velocity
  • (2) Constant acceleration
  • (3) Constant velocity but varying acceleration
  • (4) Varying velocity and varying acceleration

Correct Answer: (4) Varying velocity and varying acceleration
View Solution:


Question 22:
In the following circuit, the equivalent capacitance between terminal A and terminal B is:

Capacitor Circuit Diagram

  • (1) 2 μF
  • (2) 1 μF
  • (3) 0.5 μF
  • (4) 4 μF

Correct Answer: (1) 2 μF

View Solution


Question 23:
A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 N m-1, then the excess force required to take it away from the surface is:

  • (1) 19.8 mN
  • (2) 198 N
  • (3) 1.98 mN
  • (4) 99 N

Correct Answer: (1) 19.8 mN

View Solution


Question 24:
The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus, respectively, are 8 × 108 N/m2 and 2 × 1011 N/m2, is:

  • (1) 4 mm
  • (2) 0.4 mm
  • (3) 40 mm
  • (4) 8 mm

Correct Answer: (1) 4 mm
View Solution


Question 25:
 

Nuclear Emission Diagram

  • (1) 280, 81
  • (2) 286, 80
  • (3) 288, 82
  • (4) 286, 81

Correct Answer: (4)
View Solution


Question 26:
At any instant of time t, the displacement of any particle is given by x = 2t - 1 (in SI units) under the influence of a force of 5 N. The value of instantaneous power is (in SI units):

  • (1) 10
  • (2) 5
  • (3) 7
  • (4) 6

Correct Answer: (1) 10
View Solution


Question 27:
The quantities which have the same dimensions as those of solid angle are:

  • (1) strain and angle
  • (2) stress and angle
  • (3) strain and arc
  • (4) angular speed and stress

Correct Answer: (1) strain and angle
View Solution


Question 28:
The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 g cm². The length of the 400 g rod is nearly:

  • (1) 8.5 cm
  • (2) 17.5 cm
  • (3) 20.7 cm
  • (4) 72.0 cm

Correct Answer: (1) 8.5 cm
View Solution


Question 29:
Consider the following statements A and B and identify the correct answer:

A. For a solar-cell, the I-V characteristics lie in the IV quadrant of the given graph.
B. In a reverse biased pn junction diode, the current measured in (μA) is due to majority charge carriers.

I-V Characteristics Graph

  • (1) A is correct but B is incorrect
  • (2) A is incorrect but B is correct
  • (3) Both A and B are correct
  • (4) Both A and B are incorrect

Correct Answer: (1) A is correct but B is incorrect
View Solution


Question 30:
A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is v in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)?

Rolling Wheel Diagram

  • (1) Point P moves slower than point Q
  • (2) Point P moves faster than point Q
  • (3) Both the points P and Q move with equal speed
  • (4) Point P has zero speed

Correct Answer: (2) Point P moves faster than point Q
View Solution


Question 31:
A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as \( 4\pi \times 10^{-7} \, \text{S.I units} \)):

  • (1) 44 mT
  • (2) 4.4 T
  • (3) 4.4 mT
  • (4) 44 T

Correct Answer: (3) 4.4 mT
View Solution


Question 32:
If the monochromatic source in Young’s double slit experiment is replaced by white light, then:

  • (1) Interference pattern will disappear
  • (2) There will be a central dark fringe surrounded by a few coloured fringes
  • (3) There will be a central bright white fringe surrounded by a few coloured fringes
  • (4) All bright fringes will be of equal width

Correct Answer: (3) There will be a central bright white fringe surrounded by a few coloured fringes
View Solution


Question 33:
Match List-I with List-II.

Material Susceptibility (χ)
Diamagnetic χ = 0
Ferromagnetic 0 ≥ χ ≥ -1
Paramagnetic χ >> 1
Non-magnetic 0 < χ < ε (a small positive number)
  • (1) A-II, B-III, C-IV, D-I
  • (2) A-II, B-I, C-III, D-IV
  • (3) A-III, B-II, C-I, D-IV
  • (4) A-IV, B-III, C-II, D-I

Correct Answer: (1) A-II, B-III, C-IV, D-I
View Solution


Question 34:
A light ray enters through a right-angled prism at point P with the angle of incidence 30° as shown in figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the prism is:

  • (1) √5 / 4
  • (2) √5 / 2
  • (3) √3 / 4
  • (4) √3 / 2

Correct Answer: (2) √5 / 2
View Solution


Question 35:
The mass of a planet is 1/10th that of the Earth and its diameter is half that of the Earth. The acceleration due to gravity on that planet is:

  • (1) 19.6 m/s²
  • (2) 9.8 m/s²
  • (3) 4.9 m/s²
  • (4) 3.92 m/s²

Correct Answer: (4) 3.92 m/s²
View Solution

Question 36:
The minimum energy required to launch a satellite of mass m from the surface of the Earth of mass M and radius R in a circular orbit at an altitude of 2R from the surface of the Earth is:

  • (1) 5/6 * (GmM/R)
  • (2) 2/3 * (GmM/R)
  • (3) GmM/(2R)
  • (4) GmM/(3R)

Correct Answer: (1) 5/6 * (GmM/R)
View Solution


Question 37:
A metallic bar of Young’s modulus 0.5 * 10^11 N/m² and coefficient of linear thermal expansion 10^-5 °C⁻¹, length 1 m and area of cross-section 10^-3 m², is heated from 0°C to 100°C without expansion or bending. The compressive force developed in it is:

  • (1) 5 * 10^3 N
  • (2) 50 * 10^3 N
  • (3) 100 * 10^3 N
  • (4) 2 * 10^3 N

Correct Answer: (2) 50 * 10^3 N
View Solution


Question 38:
A small telescope has an objective of focal length 140 cm and an eyepiece of focal length 5.0 cm. The magnifying power of the telescope for viewing a distant object is:

  • (1) 34
  • (2) 28
  • (3) 17
  • (4) 32

Correct Answer: (2) 28
View Solution


Question 39:
A 10 µF capacitor is connected to a 210 V, 50 Hz source as shown in the figure. The peak current in the circuit is nearly (π = 3.14):

  • (1) 0.58 A
  • (2) 0.93 A
  • (3) 1.20 A
  • (4) 0.35 A

Correct Answer: (2) 0.93 A
View Solution


Question 40:
If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is x/2 times its original time period. Then the value of x is:

  • (1) √3
  • (2) √2
  • (3) 2√3
  • (4) 4

Correct Answer: (2) √2
View Solution


Question 41:
The property which is not of an electromagnetic wave travelling in free space is that:

  • (1) They are transverse in nature
  • (2) The energy density in electric field is equal to energy density in magnetic field
  • (3) They travel with a speed equal to 1 / sqrt(μ₀ ε₀)
  • (4) They originate from charges moving with uniform speed

Correct Answer: (4) They originate from charges moving with uniform speed
View Solution


Question 42:
The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume) at three pressures P₁, P₂, and P₃ compared with those of Charles’s law represented as dotted lines. Then the correct relation is:

Graph

  • (1) P₃ > P₂ > P₁
  • (2) P₁ > P₃ > P₂
  • (3) P₂ > P₁ > P₃
  • (4) P₁ > P₂ > P₃

Correct Answer: (4) P₁ > P₂ > P₃
View Solution


Question 43:
A force defined by F = α t² + β t acts on a particle at a given time t. The factor which is dimensionless, if α and β are constants, is:

  • (1) β t / α
  • (2) α t / β
  • (3) α β t
  • (4) α β / t

Correct Answer: (2) α t / β
View Solution


Question 45:
Two heaters A and B have power ratings of 1 kW and 2 kW, respectively. These two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

  • (1) 1 : 1
  • (2) 2 : 9
  • (3) 1 : 2
  • (4) 2 : 3

Correct Answer: (2) 2 : 9
View Solution


Question 46:
Choose the correct circuit which can achieve the bridge balance.

Circuit Diagram

Correct Answer: (1)
View Solution


Question 47:
A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:

  • A. Hold the sheet there if it is magnetic.
  • B. Hold the sheet there if it is non-magnetic.
  • C. Move the sheet away from the pole with uniform velocity if it is conducting.
  • D. Move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.

Choose the correct statement(s) from the options given below:

  • (1) B and D only
  • (2) A and C only
  • (3) A, C and D only
  • (4) C only

Correct Answer: (2) A and C only
View Solution


Question 48:

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then:

  • A. The charge stored in it increases.
  • B. The energy stored in it decreases.
  • C. Its capacitance increases.
  • D. The ratio of charge to its potential remains the same.
  • E. The product of charge and voltage increases.

Choose the most appropriate answer from the options given below:

  • (1) A, B and E only
  • (2) A, C and E only
  • (3) B, D and E only
  • (4) A, B and C only

Correct Answer: (2) A, C and E only
View Solution


Question 49:
An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms make an angle of 60° with each other. The magnetic moment of this new magnet is:

  • (1) M
  • (2) M/2
  • (3) 2M
  • (4) M/√3

Correct Answer: (2) M/2
View Solution


Question 50:
A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates:

  • (1) There is no current
  • (2) Displacement current of magnitude equal to I flows in the same direction as I
  • (3) Displacement current of magnitude equal to I flows in a direction opposite to that of I
  • (4) Displacement current of magnitude greater than I flows but can be in any direction

Correct Answer: (2) Displacement current of magnitude equal to I flows in the same direction as I
View Solution


Question 51:
On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as:

  • (1) Crystallization
  • (2) Sublimation
  • (3) Distillation
  • (4) Chromatography

Correct Answer: (2) Sublimation
View Solution


Question 52:
Match List I with List II:

List I List II
A. Isothermal process I. No heat exchange
B. Isochoric process II. Carried out at constant temperature
C. Isobaric process III. Carried out at constant volume
D. Adiabatic process IV. Carried out at constant pressure

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-II, D-I
  • (2) A-IV, B-II, C-III, D-I
  • (3) A-I, B-II, C-III, D-IV
  • (4) A-II, B-III, C-IV, D-I

Correct Answer: (4) A-II, B-III, C-IV, D-I
View Solution


Question 53:
In which of the following equilibria, Kp and Kc are NOT equal?

  • (1) PCl5 (g) ⇌ PCl3 (g) + Cl2 (g)
  • (2) H2 (g) + I2 (g) ⇌ 2 HI (g)
  • (3) CO (g) + H2 (g) ⇌ CO2 (g) + H2O (g)
  • (4) Br2 (g) ⇌ 2 Br (g)

Correct Answer: (1) PCl5 (g) ⇌ PCl3 (g) + Cl2 (g)
View Solution


Question 54:
The compound that will undergo SN1 reaction with the fastest rate is:

Image

  • (1) Compound A
  • (2) Compound B
  • (3) Compound C
  • (4) Compound D

Correct Answer: (4) Compound D
View Solution


Question 55:
A compound with a molecular formula of C₆H₁₄ has two tertiary carbons. Its IUPAC name is:

  • (1) n-hexane
  • (2) 2-methylpentane
  • (3) 2,3-dimethylbutane
  • (4) 2,2-dimethylbutane

Correct Answer: (3) 2,3-dimethylbutane
View Solution


Question 56:
Given below are two statements:

Statement I: The boiling point of hydrides of Group 16 elements follow the order H₂O > H₂Te > H₂Se > H₂S.

Statement II: On the basis of molecular mass, H₂O is expected to have a lower boiling point than the other members of the group but due to the presence of extensive hydrogen bonding in H₂O, it has a higher boiling point.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are true
  • (2) Both Statement I and Statement II are false
  • (3) Statement I is true but Statement II is false
  • (4) Statement I is false but Statement II is true

Correct Answer: (1) Both Statement I and Statement II are true
View Solution


Question 57:
For the reaction 2A ⇌ B + C, Kc = 4 × 10⁻³. At a given time, the composition of the reaction mixture is: [A] = [B] = [C] = 2 × 10⁻³ M. Then, which of the following is correct?

  • (1) Reaction is at equilibrium.
  • (2) Reaction has a tendency to go in the forward direction.
  • (3) Reaction has a tendency to go in the backward direction.
  • (4) Reaction has gone to completion in the forward direction.

Correct Answer: (3) Reaction has a tendency to go in the backward direction.
View Solution


Question 58:
Activation energy of any chemical reaction can be calculated if one knows the value of:

  • (1) rate constant at standard temperature
  • (2) probability of collision
  • (3) orientation of reactant molecules during collision
  • (4) rate constant at two different temperatures

Correct Answer: (4) rate constant at two different temperatures
View Solution


Question 59:
Given below are two statements:

Statement I: Both [Co(NH₃)₆]³⁺ and [CoF₆]³⁻ complexes are octahedral but differ in their magnetic behaviour.

Statement II: [Co(NH₃)₆]³⁺ is diamagnetic whereas [CoF₆]³⁻ is paramagnetic.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are true
  • (2) Both Statement I and Statement II are false
  • (3) Statement I is true but Statement II is false
  • (4) Statement I is false but Statement II is true

Correct Answer: (1) Both Statement I and Statement II are true
View Solution


Question 60:
The highest number of helium atoms is in:

  • (1) 4 mol of helium
  • (2) 4 u of helium
  • (3) 4 g of helium
  • (4) 2.271098 L of helium at STP

Correct Answer: (1) 4 mol of helium
View Solution


Question 61:

Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N

Choose the correct answer from the options given below:

  • (1) Li < Be < B < C < N
  • (2) Li < B < Be < C < N
  • (3) Li < Be < C < B < N
  • (4) Li < Be < N < B < C

Correct Answer: (2) Li < B < Be < C < N
View Solution


Question 62:
Which one of the following alcohols reacts instantaneously with Lucas reagent?

A.Structure A

B.Structure B

C.Structure C

D.Structure D

Correct Answer: D
View Solution


Question 63.
‘Spin only’ magnetic moment is same for which of the following ions?

A. Ti3+

B. Cr2+

C. Mn2+

D. Fe2+

E. Sc3+

Choose the most appropriate answer from the options given below:

  • (1) B and D only
  • (2) A and E only
  • (3) B and C only
  • (4) A and D only
Correct Answer: (1) B and D only
View Solution

Question 64.
The reagents with which glucose does not react to give the corresponding tests/products are:

A. Tollen’s reagent

B. Schiff’s reagent

C. HCN

D. NH2OH

E. NaHSO3

Choose the correct options from the given below:

  • (1) B and C
  • (2) A and D
  • (3) B and E
  • (4) E and D
Correct Answer: (3) B and E
View Solution

Question 65.
Given below are two statements:

Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.

Statement II: Aniline cannot be prepared through Gabriel synthesis.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both statement I and Statement II are true
  • (2) Both statement I and Statement II are false
  • (3) Statement I is correct but Statement II is false
  • (4) Statement I is incorrect but Statement II is true
Correct Answer: (1) Both statement I and Statement II are true
View Solution

Question 66.
The energy of an electron in the ground state (n = 1) for He+ ion is -x J, then that for an electron in n = 2 state for Be3+ ion in J is:

  • (1) -x
  • (2) -x/9
  • (3) -4x
  • (4) 4x/9
Correct Answer: (1) -x
View Solution

Question ​67:
Which plot of ln k vs 1/T is consistent with the Arrhenius equation?

Q67

Choose the most appropriate answer from the options given below:

  • (1) B and D only
  • (2) A and E only
  • (3) B and C only
  • (4) A and D only
Correct Answer: (4) A and D only
View Solution

Question ​68:
 Given below are two statements:

Statement I: The boiling point of three isomeric pentanes follows the order

n-pentane > isopentane > neopentane

Statement II: When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.

In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both Statement I and Statement II are correct
  • (2) Both Statement I and Statement II are incorrect
  • (3) Statement I is correct but Statement II is incorrect
  • (4) Statement I is incorrect but Statement II is correct
Correct Answer: (1) Both Statement I and Statement II are correct
View Solution

Question 69:
The Eo value for the Mn3+/Mn2+ couple is more positive than that of Cr3+/Cr2+ or Fe3+/Fe2+ due to the change of:

  • (1) d5 to d4 configuration
  • (2) d5 to d2 configuration
  • (3) d4 to d5 configuration
  • (4) d3 to d2 configuration
Answer: (3) d4 to d5 configuration
View Solution

Question 70: 
In which of the following processes does entropy increase?

A. A liquid evaporates to vapour.

B. The temperature of a crystalline solid is lowered from 130 K to 0 K.

C. 2NaHCO3(s) → Na2CO3(s) + CO2(g) + H2O(g)

D. Cl2(g) → 2Cl(g)

Choose the correct answer from the options given below:

  • (1) A and C
  • (2) A, B and D
  • (3) A, C and D
  • (4) C and D
Correct Answer: (3) A, C, and D
View Solution

Question 71:
Intramolecular hydrogen bonding is present in:

1.Structure 1

2.Structure 2

3.Structure 3

(4) HF

Correct Answer: (1) A
View Solution

Question 72:
Arrange the following elements in increasing order of electronegativity:

N, O, F, C, Si

Choose the correct answer from the options given below:

  • (1) Si < C < N < O < F
  • (2) Si < C < O < N < F
  • (3) O < F < N < C < Si
  • (4) F < O < N < C < Si
Correct Answer: (1) Si < C < N < O < F
View Solution

Question 73.
Which reaction is NOT a redox reaction?

  • (1) Zn + CuSO₄ → ZnSO₄ + Cu
  • (2) 2KClO₃ + I₂ → 2KIO₃ + Cl₂
  • (3) H₂ + Cl₂ → 2HCl
  • (4) BaCl₂ + Na₂SO₄ → BaSO₄ + 2NaCl
Correct Answer: (4) BaCl₂ + Na₂SO₄ → BaSO₄ + 2NaCl
View Solution

Question 74.
Match List I with List II:

List I List II
A. 1 mol of H₂O to O₂ I. 3F
B. 1 mol of 4MnO₄⁻ to Mn²⁺ II. 2F
C. 1.5 mol of Ca from molten CaCl₂ III. 1F
D. 1 mol of FeO to Fe₂O₃ IV. 5F

Choose the correct answer from the options given below:

  • (1) A-II, B-IV, C-I, D-III
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-II, B-III, C-I, D-IV
  • (4) A-III, B-IV, C-II, D-I
Correct Answer: (1) A-II, B-IV, C-I, D-III
View Solution

Question 75:
The most stable carbocation among the following is:

Carbocation Image

Correct Answer: D
View Solution

Question 76:
Match List I with List II:

Image for Question 76

Choose the correct answer from the options given below:

  • (1) A-I, B-IV, C-II, D-III
  • (2) A-IV, B-III, C-II, D-I
  • (3) A-III, B-IV, C-II, D-I
  • (4) A-III, B-IV, C-I, D-II
Correct Answer: (3) A-III, B-IV, C-II, D-I
View Solution

Question 77:
Among Group 16 elements, which one does NOT show –2 oxidation state?

  • (1) O
  • (2) Se
  • (3) Te
  • (4) Po
Correct Answer: (4) Po
View Solution

Question 78.
The Henry’s law constant (KH) values of three gases (A, B, C) in water are 145, 2 × 10-5 and 35 kbar, respectively. The solubility of these gases in water follow the order:

  • (1) B > A > C
  • (2) B > C > A
  • (3) A > C > B
  • (4) A > B > C
Correct Answer: (2) B > C > A
View Solution

Question 79.
Fehling’s solution ‘A’ is:

  • (1) aqueous copper sulphate
  • (2) alkaline copper sulphate
  • (3) alkaline solution of sodium potassium tartrate (Rochelle’s salt)
  • (4) aqueous sodium citrate
Correct Answer: (1) aqueous copper sulphate
View Solution

Question 80:
Match List I with List II:

Q80

Choose the correct answer from the options given below:

  • (1) A-IV, B-I, C-III, D-II
  • (2) A-III, B-II, C-II, D-IV
  • (3) A-IV, B-I, C-II, D-III
  • (4) A-I, B-IV, C-I, D-II
Correct Answer: (3) A-IV, B-I, C-II, D-III
View Solution

Question 81.
Identify the correct reagents that would bring about the following transformation:

Image for Question 81

Choose the correct answer from the options given below:

  • (1) Reagents 1 and 2
  • (2) Reagents 2 and 3
  • (3) Reagents 1 and 3
  • (4) Reagents 2 and 4
Correct Answer: (2)
View Solution

Question 82:
Match List I with List II:

Image for Question 82

Choose the correct answer from the options given below:

  • (1) A-I, B-IV, C-I, D-II
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-IV, B-I, C-II, D-III
  • (4) A-II, B-III, C-I, D-IV
Correct Answer: (2) A-III, B-IV, C-I, D-II
View Solution

Question 83:
Match List I with List II:

Image for Question 83

Choose the correct answer from the options given below:

  • (1) A-I, B-IV, C-II, D-III
  • (2) A-IV, B-III, C-I, D-II
  • (3) A-III, B-IV, C-II, D-I
  • (4) A-I, B-II, C-III, D-IV
Correct Answer: (1) A-I, B-IV, C-II, D-III
View Solution

Question 84:
1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution. The mass of sodium hydroxide left unreacted is equal to:

  • (1) 750 mg
  • (2) 250 mg
  • (3) Zero mg
  • (4) 200 mg
Correct Answer: (2) 250 mg
View Solution

Question 85:
Match List I with List II:

List I (Complex) List II (Type of isomerism)
A. [Co(NH3)5(NO2)]Cl2 I. Solvate isomerism
B. [Co(NH3)5(SO4)]Br II. Linkage isomerism
C. [Co(NH3)6][Cr(CN)6] III. Ionization isomerism
D. [Co(H2O)6]Cl3 IV. Coordination isomerism

Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-IV, D-I
  • (2) A-I, B-III, C-IV, D-II
  • (3) A-I, B-IV, C-III, D-II
  • (4) A-II, B-IV, C-III, D-I
Correct Answer: (1) A-II, B-III, C-IV, D-I
View Solution

Question 86:
During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe²⁺ ion?

  • (1) dilute hydrochloric acid
  • (2) concentrated sulphuric acid
  • (3) dilute nitric acid
  • (4) dilute sulphuric acid
Correct Answer: (4) dilute sulphuric acid
View Solution

Question 87:
Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.

  • (1) B, A, D, C, E
  • (2) B, C, A, D, E
  • (3) E, C, D, B, A
  • (4) E, A, B, C, D
Correct Answer: (1) B, A, D, C, E
View Solution

Question 88:
Major products A and B formed in the following reaction sequence, are:

Q88
Correct Answer: (1)
View Solution

Question 89:

The pair of lanthanoid ions which are diamagnetic is

  • (1) Ce⁴⁺ and Yb²⁺
  • (2) Ce³⁺ and Eu²⁺
  • (3) Gd³⁺ and Eu³⁺
  • (4) Pm³⁺ and Sm³⁺
Correct Answer: (1) Ce⁴⁺ and Yb²⁺
View Solution

Question 90:
Identify the correct answer:

  • (1) Three resonance structures can be drawn for ozone
  • (2) BF₃ has non-zero dipole moment
  • (3) Dipole moment of NF₃ is greater than that of NH₃
  • (4) Three canonical forms can be drawn for CO₃²⁻ ion
Correct Answer: (4) Three canonical forms can be drawn for CO₃²⁻ ion
View Solution

Question 91:

A compound X contains 32% of A, 20% of B, and the remaining percentage of C. Then, the empirical formula of X is:

  • (1) A₂BC₂
  • (2) ABC₃
  • (3) AB₂C₂
  • (4) ABC₄
Correct Answer: (2) ABC₃
View Solution

Question 92:

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is

  • (1) 0 calorie
  • (2) -413.14 calories
  • (3) 413.14 calories
  • (4) 100 calories
Correct Answer: (2) -413.14 calories
View Solution

Question 93:

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is

  • (1) 3.15 g
  • (2) 0.315 g
  • (3) 31.5 g
  • (4) 0.0315 g
Correct Answer: (2) 0.315 g
View Solution

Question 94: 
Consider the following reaction in a sealed vessel at equilibrium with concentrations of N₂ = 3.0 × 10⁻³ M, O₂ = 4.2 × 10⁻³ M and NO = 2.8 × 10⁻³ M.

2 NO(g) ↔ N₂(g) + O₂(g)

If 0.1 mol L⁻¹ of NO(g) is taken in a closed vessel, what will be the degree of dissociation (α) of NO(g) at equilibrium?

  • (1) 0.00889
  • (2) 0.0889
  • (3) 0.8889
  • (4) 0.717
Correct Answer: (4) 0.717
View Solution

Question 95: 
For the given reaction:

Image for Question 95

Identify the product 'P' formed in the reaction.

  • (1) Option 1
  • (2) Option 2
  • (3) Option 3
  • (4) Option 4
Correct Answer: (2)
View Solution

Question 96: 

The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation.

  • (1) 38.04 kJ/mol
  • (2) 380.4 kJ/mol
  • (3) 3.80 kJ/mol
  • (4) 3804 kJ/mol
Correct Answer: (1) 38.04 kJ/mol
View Solution

Question 97:

Identify the major product C formed in the following reaction sequence:

Reaction sequence for question 97
  • (1) Propylamine
  • (2) Butylamine
  • (3) Butanamide
  • (4) α-bromobutanoic acid
Correct Answer: (1) Propylamine
View Solution

Question 98: 
The products A and B obtained in the following reactions, respectively, are:

3ROH + PCl₃ → 3RCl + A

ROH + PCl₅ → RCl + HCl + B

  • (1) POCl₃ and H₃PO₃
  • (2) POCl₃ and H₃PO₄
  • (3) H₃PO₄ and POCl₃
  • (4) H₃PO₃ and POCl₃
Correct Answer: (4) H₃PO₃ and POCl₃
View Solution

Question 99: 
The plot of osmotic pressure (Π) vs concentration (mol L⁻¹) for a solution gives a straight line with slope 25.73 L bar mol⁻¹. The temperature at which the osmotic pressure measurement is done is

  • (1) 37°C
  • (2) 310°C
  • (3) 25.73°C
  • (4) 12.05°C
Correct Answer: (1) 37°C
View Solution

Question 100:
Given below are two statements:

Statement I: [Co(NH₃)₆]³⁺ is a homoleptic complex, whereas [Co(NH₃)₄Cl₂]⁺ is a heteroleptic complex.

Statement II: Complex [Co(NH₃)₆]³⁺ has only one kind of ligand, but [Co(NH₃)₄Cl₂]⁺ has more than one kind of ligand.

  • (1) Both Statement I and Statement II are true.
  • (2) Both Statement I and Statement II are false.
  • (3) Statement I is true but Statement II is false.
  • (4) Statement I is false but Statement II is true.
Correct Answer: (1) Both Statement I and Statement II are true.
View Solution

Question 101:

Spindle fibers attach to kinetochores of chromosomes during

  • (1) Metaphase
  • (2) Anaphase
  • (3) Telophase
  • (4) Prophase
Correct Answer: (1) Metaphase
View Solution

Question 102:

Bulliform cells are responsible for

  • (1) Protecting the plant from salt stress.
  • (2) Increased photosynthesis in monocots.
  • (3) Providing large spaces for storage of sugars.
  • (4) Inward curling of leaves in monocots.
Correct Answer: (4) Inward curling of leaves in monocots.
View Solution

Question 103:

The capacity to generate a whole plant from any cell of the plant is called:

  • (1) Micropropagation
  • (2) Differentiation
  • (3) Somatic hybridization
  • (4) Totipotency
Correct Answer: (4) Totipotency
View Solution

Question 104:

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream ends;

  • (1) Structural gene, Transposons, Operator gene
  • (2) Inducer, Repressor, Structural gene
  • (3) Promotor, Structural gene, Terminator
  • (4) Repressor, Operator gene, Structural gene
Correct Answer: (3) Promotor, Structural gene, Terminator
View Solution

Question 105:

Match List I with List II





Choose the correct answer from the options given below:

  • (1) A-II, B-IV, C-III, D-I
  • (2) A-III, B-I, C-IV, D-II
  • (3) A-IV, B-I, C-III, D-II
  • (4) A-III, B-I, C-II, D-IV
Correct Answer: (2) A-III, B-I, C-IV, D-II
View Solution

Question 106:

Match List I with List II



Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-III, D-IV
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-I, B-II, C-III, D-IV
Correct Answer: (2) A-III, B-IV, C-I, D-II
View Solution

Question 107:

Hind II always cuts DNA molecules at a particular point called recognition sequence, and it consists of:

  • (1) 6 bp
  • (2) 4 bp
  • (3) 10 bp
  • (4) 8 bp
Correct Answer: (1) 6 bp
View Solution

Question 108:

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

  • (1) bb
  • (2) Bb
  • (3) BB/Bb
  • (4) BB
Correct Answer: (1) bb
View Solution

Question 109:

These are regarded as major causes of biodiversity loss:

A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration

Choose the correct option:

  • (1) A, B, C and D only
  • (2) A, B and E only
  • (3) A, B and D only
  • (4) A, C and D only
Correct Answer: (3) A, B and D only
View Solution

Question 110:

How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?

  • (1) 2 molecules of ATP and 2 molecules of NADPH
  • (2) 3 molecules of ATP and 3 molecules of NADPH
  • (3) 3 molecules of ATP and 2 molecules of NADPH
  • (4) 2 molecules of ATP and 3 molecules of NADPH
Correct Answer: (3) 3 molecules of ATP and 2 molecules of NADPH
View Solution

Question 111:

Which one of the following can be explained on the basis of Mendel's Law of Dominance?

A. Out of one pair of factors, one is dominant and the other is recessive.

B. Alleles do not show any expression, and both the characters appear as such in F2 generation.

C. Factors occur in pairs in normal diploid plants.

D. The discrete unit controlling a particular character is called factor.

E. The expression of only one of the parental characters is found in a monohybrid cross.


Choose the correct answer from the options given below:

  • (1) A, C, D and E only
  • (2) B, C and D only
  • (3) A, B, C, D and E
  • (4) A, B and C only
Correct Answer: (1) A, C, D and E only
View Solution

Question 112:

List of endangered species was released by

  • (1) WWF
  • (2) FOAM
  • (3) IUCN
  • (4) GEAC
Correct Answer: (3) IUCN
View Solution

Question 113:

Tropical regions show the greatest level of species richness because

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.

B. Tropical environments are more seasonal.

C. More solar energy is available in tropics.

D. Constant environments promote niche specialization.

E. Tropical environments are constant and predictable.

Choose the correct answer from the options given below:

  • (1) A and B only
  • (2) A, B and E only
  • (3) A, B and D only
  • (4) A, C, D and E only
Correct Answer: (4) A, C, D and E only
View Solution

Question 114:

Match List I with List II




Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-I, D-IV
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-I, B-II, C-III, D-IV
  • (4) A-III, B-II, C-IV, D-I
Correct Answer: (4) A-III, B-II, C-IV, D-I
View Solution

Question 115:

Which of the following is an example of an actinomorphic flower?

  • (1) Cassia
  • (2) Pisum
  • (3) Sesbania
  • (4) Datura
Correct Answer: (4) Datura
View Solution

Question 116:

Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.

B. The flowers of water lily are not pollinated by water.

C. In most of water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon-like.

E. In some hydrophytes, the pollen grains are carried passively inside water.

Choose the correct answer from the options given below:

  • (1) A, B, C and D only
  • (2) A, C, D and E only
  • (3) B, C, D and E only
  • (4) C, D and E only
Correct Answer: (3) B, C, D and E only
View Solution

Question 117:

What is the fate of a piece of DNA carrying only the gene of interest which is transferred into an alien organism?

  • (A) The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
    (B) It may get integrated into the genome of the recipient.
    (C) It may multiply and be inherited along with the host DNA.
    (D) The alien piece of DNA is not an integral part of the chromosome.
    (E) It shows the ability to replicate.
Correct Answer: (2) B and C only
View Solution

Question 118:

Given below are two statements:

Statement I: Parenchyma is living, but collenchyma is dead tissue.

Statement II: Gymnosperms lack xylem vessels, but the presence of xylem vessels is the characteristic of angiosperms.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (3) Statement I is false but Statement II is true
View Solution

Question 119:

Formation of interfascicular cambium from fully developed parenchyma cells is an example of

  • (1) Redifferentiation
  • (2) Dedifferentiation
  • (3) Maturation
  • (4) Differentiation
Correct Answer: (2) Dedifferentiation
View Solution

Question 120:

Which one of the following is not a criterion for classification of fungi?

  • (1) Mode of nutrition
  • (2) Mode of spore formation
  • (3) Fruiting body
  • (4) Morphology of mycelium
Correct Answer: (1) Mode of nutrition
View Solution

Question 121:

The cofactor of the enzyme carboxypeptidase is:

  • (1) Niacin
  • (2) Flavin
  • (3) Haem
  • (4) Zinc
Correct Answer: (4) Zinc
View Solution

Question 122:

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

  • (1) promotes abscission of mature leaves only.
  • (2) does not affect mature monocotyledonous plants.
  • (3) can help in cell division in grasses, to produce growth.
  • (4) promotes apical dominance.
Correct Answer: (2) does not affect mature monocotyledonous plants.
View Solution

Question 123:

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

  • (1) Red flowered as well as pink flowered plants
  • (2) Only pink flowered plants
  • (3) Red, Pink as well as white flowered plants
  • (4) Only red flowered plants
Correct Answer: (1) Red flowered as well as pink flowered plants
View Solution

Question 124:

Which of the following are required for the dark reaction of photosynthesis?
A. Light

B. Chlorophyll

C. CO₂

D. ATP

E. NADPH

Choose the correct answer from the options given below:

  • (1) B, C and D only
  • (2) C, D and E only
  • (3) D and E only
  • (4) A, B and C only
Correct Answer: (2) C, D and E only
View Solution

Question 125:

Match List I with List II







Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-III, B-II, C-I, D-IV
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-III, B-II, C-IV, D-I
Correct Answer: (4) A-III, B-II, C-IV, D-I
View Solution

Question 126:

The lactose present in the growth medium of bacteria is transported to the cell by the action of

  • (1) Acetylase
  • (2) Permease
  • (3) Polymerase
  • (4) Beta-galactosidase
Correct Answer: (2) Permease
View Solution

Question 127:

The equation of Verhulst-Pearl logistic growth is \[ \frac{dN}{dt} = rN \left( 1 - \frac{N}{K} \right) \]
From this equation, \( K \) indicates:

  • (1) Biotic potential
  • (2) Carrying capacity
  • (3) Population density
  • (4) Intrinsic rate of natural increase
Correct Answer: (2) Carrying capacity
View Solution

Question 128:

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

  • (1) Feedback inhibition
  • (2) Competitive inhibition
  • (3) Enzyme activation
  • (4) Cofactor inhibition
Correct Answer: (2) Competitive inhibition
View Solution

Question 129:

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special settings where they can be protected and given special care is called

  • (1) Biodiversity conservation
  • (2) Semi-conservative method
  • (3) Sustainable development
  • (4) In-situ conservation
Correct Answer: (1) Biodiversity conservation
View Solution

Question 130:

Identify the type of flowers based on the position of calyx, corolla, and androecium with respect to the ovary from the given figures (a) and (b)


  • (1) (a) Hypogynous; (b) Epigynous
  • (2) (a) Perigynous; (b) Epigynous
  • (3) (a) Perigynous; (b) Perigynous
  • (4) (a) Epigynous; (b) Hypogynous
Correct Answer: (3) (a) Perigynous; (b) Perigynous
View Solution

Question 131:

Given below are two statements:

Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.

Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect, the inactive protoxin gets converted into the active form due to the acidic pH of the insect gut.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (2) Statement I is true but Statement II is false
View Solution

Question 132:

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

  • (1) Phospholipids
  • (2) Glycerides
  • (3) Carbohydrates
  • (4) Amino acids
Correct Answer: (1) Phospholipids
View Solution

Question 133:

Given below are two statements:
Statement I: Chromosomes become gradually visible under light microscope during the leptotene stage.

Statement II: The beginning of the diplotene stage is recognized by the dissolution of the synaptonemal complex.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (4) Both Statement I and Statement II are true
View Solution

Question 134:

Identify the part of the seed from the given figure which is destined to form the root when the seed germinates.


  • (1) B
  • (2) C
  • (3) D
  • (4) A
Correct Answer: (2) C
View Solution

Question 135:

In the given figure, which component has thin outer walls and highly thickened inner walls?


  • (1) D
  • (2) A
  • (3) B
  • (4) C
Correct Answer: (4) C
View Solution

Question 136:

Match List-I with List-II



Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-III, D-IV
  • (2) A-II, B-III, C-IV, D-I
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-IV, B-I, C-II, D-III
Correct Answer: (4) A-IV, B-I, C-II, D-III
View Solution

Question 137:

Match List I with List II





Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-III, D-IV
  • (2) A-II, B-I, C-IV, D-III
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-IV, B-III, C-II, D-I
Correct Answer: (1) A-I, B-II, C-III, D-IV
View Solution

Question 138:

Match List I with List II




Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-IV, D-II
  • (2) A-I, B-III, C-II, D-IV
  • (3) A-III, B-IV, C-II, D-I
  • (4) A-II, B-III, C-I, D-IV
Correct Answer: (1) A-III, B-I, C-IV, D-II
View Solution

Question 139:

Spraying sugarcane crop with which of the following plant growth regulators increases the length of stem, thus, increasing the yield?

  • (1) Gibberellin
  • (2) Cytokinin
  • (3) Abscisic acid
  • (4) Auxin
Correct Answer: (1) Gibberellin
View Solution

Question 140:

Match List I with List II




Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-I, D-II
  • (2) A-II, B-III, C-IV, D-I
  • (3) A-IV, B-I, C-II, D-III
  • (4) A-III, B-II, C-I, D-IV
Correct Answer: (1) A-III, B-IV, C-I, D-II
View Solution

Question 141:

In an ecosystem, if the Net Primary Productivity (NPP) of the first trophic level is 100x (kcal m–2 yr–1), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

  • (1) \( x \, kcal m^{-2} \, yr^{-1} \)
  • (2) \( 10x \, kcal m^{-2} \, yr^{-1} \)
  • (3) \( 100x \, kcal m^{-2} \, yr^{-1} \)
  • (4) \( 10x \, kcal m^{-2} \, yr^{-1} \)
Correct Answer: (2) \( 10x \, \text{kcal m}^{-2} \, \text{yr}^{-1} \)
View Solution

Question 142:

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

  • (1) Succinic acid → Malic acid
  • (2) Succinyl-CoA → Succinic acid
  • (3) Isocitrate → α-ketoglutaric acid
  • (4) Malic acid → Oxaloacetic acid
Correct Answer: (2) Succinyl-CoA → Succinic acid
View Solution

Question 143:

Which of the following are fused in somatic hybridization involving two varieties of plants?

  • (1) Somatic embryos
  • (2) Protoplasts
  • (3) Pollens
  • (4) Callus
Correct Answer: (2) Protoplasts
View Solution

Question 144:

Match List I with List II




Choose the correct answer from the options given below:

  • (1) A-IV, B-I, C-II, D-III
  • (2) A-I, B-II, C-IV, D-III
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-IV, B-II, C-I, D-III
Correct Answer: (4) A-IV, B-II, C-I, D-III
View Solution

Question 145:

Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.

Choose the correct answer from the options given below:

  • (1) B, C, D and E only
  • (2) A, C, D and E only
  • (3) A, B, C and E only
  • (4) A, B, C and D only
Correct Answer: (2) A, C, D and E only
View Solution

Question 146:

Which of the following statement is correct regarding the process of replication in E. coli?

  • (1) The DNA-dependent RNA polymerase catalyses polymerization in one direction, that is 5’ → 3’
  • (2) The DNA-dependent DNA polymerase catalyses polymerization in 5’ → 3’ as well as 3’ → 5’ direction
  • (3) The DNA-dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction
  • (4) The DNA-dependent DNA polymerase catalyses polymerization in one direction that is 3’ → 5’
Correct Answer: (3) The DNA-dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction
View Solution

Question 147:

The DNA present in chloroplast is:

  • (1) Circular, double-stranded
  • (2) Linear, single-stranded
  • (3) Circular, single-stranded
  • (4) Linear, double-stranded
Correct Answer: (1) Circular, double-stranded
View Solution

Question 148:

Identify the correct description about the given figure:


  • (1) Water-pollinated flowers showing stamens with mucilaginous covering.
  • (2) Cleistogamous flowers showing autogamy.
  • (3) Compact inflorescence showing complete autogamy
  • (4) Wind-pollinated plant inflorescence showing flowers with well-exposed stamens.
Correct Answer: (4) Wind-pollinated plant inflorescence showing flowers with well-exposed stamens.
View Solution

Question 149:

Given below are two statements:

Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.

Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (2) Statement I is true but Statement II is false
View Solution

Question 150:

Match List I with List II



Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-III, D-IV
  • (2) A-IV, B-III, C-II, D-I
  • (3) A-II, B-III, C-IV, D-I
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (4) A-II, B-IV, C-I, D-III
View Solution

Question 151:

Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:




Name of muscle/location

  • (1) (a) Skeletal - Triceps
          (b) Smooth – Stomach
         (c) Cardiac – Heart
  • (2) (a) Skeletal - Biceps
         (b) Involuntary – Intestine
         (c) Smooth – Heart
  • (3) (a) Involuntary – Nose tip
         (b) Skeletal – Bone
        (c) Cardiac – Heart
  • (4) (a) Smooth - Toes
        (b) Skeletal – Legs
        (c) Cardiac – Heart
Correct Answer:(1) (a) Skeletal - Triceps
      (b) Smooth – Stomach
     (c) Cardiac – Heart
View Solution

Question 152:

Following are the stages of the pathway for conduction of an action potential through the heart:
A. AV bundle \quad B. Purkinje fibres \quad C. AV node \quad D. Bundle branches \quad E. SA node
Choose the correct sequence of the pathway from the options given below:

  • (1) A-E-C-B-D
  • (2) B-D-E-C-A
  • (3) E-A-D-B-C
  • (4) E-C-A-D-B
Correct Answer: (4) E-C-A-D-B
View Solution

Question 153:

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

  • (1) Genetic drift
  • (2) Gene migration
  • (3) Constant gene pool
  • (4) Genetic recombination
Correct Answer: (3) Constant gene pool
View Solution

Question 154:

Which of the following statements is incorrect?

  • (1) Most commonly used bio-reactors are of stirring type
  • (2) Bio-reactors are used to produce small-scale bacterial cultures
  • (3) Bio-reactors have an agitator system, an oxygen delivery system, and foam control system
  • (4) A bio-reactor provides optimal growth conditions for achieving the desired product
Correct Answer: (2) Bio-reactors are used to produce small-scale bacterial cultures
View Solution

Question 155:

Which one is the correct product of DNA-dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’

  • (1) 5’AUGUAAAGUUUAUAGGUAAGU3’
  • (2) 5’AUGUACCGUUUAUAGGGAAGU3’
  • (3) 5’ATGTACCGTTTATAGGTAAGT3’
  • (4) 5’AUGUACCGUUUAUAGGUAAGU3’
Correct Answer: (4) 5’AUGUACCGUUUAUAGGUAAGU3’
View Solution

Question 156:

Match List I with List II

 



Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-II, D-IV
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-II, B-IV, C-I, D-III
  • (4) A-II, B-I, C-IV, D-III
Correct Answer: (2) A-III, B-IV, C-I, D-II
View Solution

Question 157:

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

  • (1) A, B & E only
  • (2) B, C & E only
  • (3) C, D & E only
  • (4) A, B & D only
Correct Answer: (1) A, B & E only
View Solution

Question 158:

Match List I with List II:


Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-IV, D-I
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-IV, B-I, C-II, D-III
  • (4) A-I, B-II, C-III, D-IV
Correct Answer: (2) A-III, B-IV, C-I, D-II
View Solution

Question 159:

Given below are two statements:

Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (1) Both Statement I and Statement II are false
View Solution

Question 160:

Match List I with List
II:



Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-II, D-I
  • (2) A-I, B-III, C-II, D-IV
  • (3) A-II, B-I, C-III, D-IV
  • (4) A-II, B-III, C-I, D-IV
Correct Answer: (1) A-III, B-IV, C-II, D-I
View Solution

Question 161:

Match List I with List II:




Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-II, B-I, C-IV, D-III
  • (4) A-IV, B-III, C-II, D-I
Correct Answer: (3) A-II, B-I, C-IV, D-III
View Solution

Question 162:

Match List I with List II:






Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-II, B-III, C-I, D-IV
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (3) A-III, B-I, C-IV, D-II
View Solution

Question 163:

Match List I with List II:






Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-II, D-IV
  • (2) A-IV, B-I, C-II, D-III
  • (3) A-III, B-II, C-I, D-IV
  • (4) A-II, B-I, C-III, D-IV
Correct Answer: (1) A-III, B-I, C-II, D-IV
View Solution

Question 164:

Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase
Choose the correct sequence of stages from the options given below:

  • (1) E-B-D-A-C
  • (2) B-D-E-A-C
  • (3) E-C-A-D-B
  • (4) C-E-D-A-B
Correct Answer: (3) E-C-A-D-B
View Solution

Question 165:

Match List I with List II






Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-IV, D-II
  • (2) A-IV, B-I, C-II, D-III
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-III, B-I, C-II, D-IV
Correct Answer: (3) A-III, B-I, C-IV, D-II
View Solution

Question 166:

Match List I with List II:





Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-I, D-IV
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-IV, B-I, C-III, D-II
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (2) A-II, B-IV, C-I, D-III
View Solution

Question 167:

Match List I with List II:





Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-IV, D-I
  • (2) A-II, B-I, C-IV, D-III
  • (3) A-I, B-III, C-II, D-IV
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (4) A-II, B-IV, C-I, D-III
View Solution

Question 168:

Match List I with List II:







Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-II, B-I, C-III, D-IV
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-IV, B-III, C-I, D-II
Correct Answer: (3) A-III, B-IV, C-I, D-II
View Solution

Question 169:

The flippers of the Penguins and Dolphins are the example of:

  • (1) Natural selection
  • (2) Convergent evolution
  • (3) Divergent evolution
  • (4) Adaptive radiation
Correct Answer: (2) Convergent evolution
View Solution

Question 170:

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both A and R are correct but R is NOT the correct explanation of A
  • (2) A is correct but R is not correct
  • (3) A is not correct but R is correct
  • (4) Both A and R are correct and R is the correct explanation of A
Correct Answer: (4) Both A and R are correct and R is the correct explanation of A
View Solution

Question 171:

Which of the following is not a component of the Fallopian tube?

  • (1) Isthmus
  • (2) Infundibulum
  • (3) Ampulla
  • (4) Uterine fundus
Correct Answer: (4) Uterine fundus
View Solution

Question 172:

Match List I with List II:






Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-I, D-II
  • (2) A-III, B-I, C-IV, D-II
  • (3) A-II, B-IV, C-III, D-I
  • (4) A-I, B-III, C-II, D-IV
Correct Answer: (1) A-IV, B-III, C-I, D-II
View Solution

Question 173:

Match List I with List II:






Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-III, B-I, C-II, D-IV
  • (3) A-IV, B-II, C-III, D-I
  • (4) A-II, B-IV, C-III, D-I
Correct Answer: (2) A-III, B-I, C-II, D-IV
View Solution

Question 174:

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)
A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus
Choose the correct sequence of human evolution from the options given below:

  • (1) B-A-D-C
  • (2) C-B-D-A
  • (3) A-D-C-B
  • (4) D-A-C-B
Correct Answer: (3) A-D-C-B
View Solution

Question 175:

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both A and R are true but R is NOT the correct explanation of A
  • (2) A is true but R is false
  • (3) A is false but R is true
  • (4) Both A and R are true and R is the correct explanation of A
Correct Answer: (3) A is false but R is true
View Solution

Question 176:

Which of the following is not a steroid hormone?

  • (1) Testosterone
  • (2) Progesterone
  • (3) Glucagon
  • (4) Cortisol
Correct Answer: (3) Glucagon
View Solution

Question 177:

Consider the following statements:

A. Annelids are true coelomates.

B. Poriferans are pseudocoelomates.

C. Aschelminthes are acoelomates.

D. Platyhelminthes are pseudocoelomates.

Choose the correct answer from the options given below:

  • (1) A only
  • (2) C only
  • (3) D only
  • (4) B only
Correct Answer: (1) A only
View Solution

Question 178:

Match List I with List II:



Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-IV, D-III
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (2) A-II, B-IV, C-I, D-III
View Solution

Question 179:

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

  • (1) High pO2 and Lesser H+ concentration
  • (2) Low pCO2 and High H+ concentration
  • (3) Low pCO2 and High temperature
  • (4) High pO2 and High pCO2
Correct Answer: (1) High pO2 and Lesser H+ concentration
View Solution

Question 180:

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

  • (1) 10th segment
  • (2) 8th and 9th segment
  • (3) 11th segment
  • (4) 5th segment
Correct Answer: (1) 10th segment
View Solution

Question 181:

Match List I with List II:






Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-IV, D-III
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (1) A-II, B-I, C-IV, D-III
View Solution

Question 182:

The “Ti plasmid” of Agrobacterium tumefaciens stands for:

  • (1) Tumor independent plasmid
  • (2) Tumor inducing plasmid
  • (3) Temperature independent plasmid
  • (4) Tumor inhibiting plasmid
Correct Answer: (2) Tumor inducing plasmid
View Solution

Question 183:

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: The presence or absence of hymen is not a reliable indicator of virginity.

Reason R: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (2) Statement I is true but Statement II is false
View Solution

Question 184:

The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:


  • (1) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
  • (2) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
  • (3) Gene ’X’ is responsible for recognition sites and ‘Y’ is responsible for antibiotic resistance.
  • (4) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.
Correct Answer: (1) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
View Solution

Question 185:

Which of the following is not a natural/traditional contraceptive method?

  • (1) Periodic abstinence
  • (2) Lactational amenorrhea
  • (3) Vaults
  • (4) Coitus interruptus
Correct Answer: (3) Vaults
View Solution

Question 186:

Match List I with List II:





Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-I, D-III
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-I, B-III, C-II, D-IV
Correct Answer: (3) A-III, B-IV, C-I, D-II
View Solution

Question 187:

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.


  • (1) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
  • (2) FSH, Sertoli cells, Leydig cells, spermatogenesis.
  • (3) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
  • (4) FSH, Leydig cells, Sertoli cells, spermiogenesis.
Correct Answer: (4) FSH, Leydig cells, Sertoli cells, spermiogenesis.
View Solution

Question 188:

Given below are two statements:

Statement I: Mitochondria and chloroplasts both are double-membrane bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.

In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both Statement I and Statement II are incorrect.
  • (2) Statement I is correct but Statement II is incorrect.
  • (3) Statement I is incorrect but Statement II is correct.
  • (4) Both Statement I and Statement II are correct.
Correct Answer: (2) Statement I is correct but Statement II is incorrect.
View Solution

Question 189:

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false.
  • (2) Statement I is true but Statement II is false.
  • (3) Statement I is false but Statement II is true.
  • (4) Both Statement I and Statement II are true.
Correct Answer: (3) Statement I is false but Statement II is true.
View Solution

Question 190:

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:

A. Substrate-enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.

Choose the correct answer from the options given below:

  • (1) A, E, B, D, C
  • (2) B, A, C, D, E
  • (3) E, D, C, B, A
  • (4) E, A, D, C, B
Correct Answer: (4) E, A, D, C, B
View Solution

Question 191:

Match List I with List II:




Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-IV, D-I
  • (2) A-II, B-III, C-I, D-IV
  • (3) A-IV, B-II, C-I, D-III
  • (4) A-I, B-III, C-IV, D-II
Correct Answer: (1) A-III, B-II, C-IV, D-I
View Solution

Question 192:

Match List I with List II:



Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-IV, D-I
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-IV, B-III, C-I, D-II
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (3) A-IV, B-III, C-I, D-II
View Solution

Question 193:

Given below are two statements:

Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both Statement I and Statement II are incorrect.
  • (2) Statement I is correct but Statement II is incorrect.
  • (3) Statement I is incorrect but Statement II is correct.
  • (4) Both Statement I and Statement II are correct.
Correct Answer: (2) Statement I is correct but Statement II is incorrect.
View Solution

Question 194:

Match List I with List II related to digestive system of cockroach:




Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-III, D-IV
  • (2) A-IV, B-III, C-II, D-I
  • (3) A-III, B-II, C-IV, D-I
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (4) A-IV, B-II, C-III, D-I
View Solution

Question 195:

Match List I with List II:




Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-II, D-IV
  • (2) A-I, B-II, C-IV, D-III
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-II, B-I, C-III, D-IV
Correct Answer: (3) A-III, B-I, C-IV, D-II
View Solution

Question 196:

Given below are two statements:
Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.
Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.
In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both Statement I and Statement II are incorrect.
  • (2) Statement I is correct but Statement II is incorrect.
  • (3) Statement I is incorrect but Statement II is correct.
  • (4) Both Statement I and Statement II are correct.
Correct Answer: (4) Both Statement I and Statement II are correct.
View Solution

Question 197:

Match List I with List II:




Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-I, D-II
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-II, B-I, C-IV, D-III
  • (4) A-II, B-I, C-III, D-IV
Correct Answer: (2) A-III, B-IV, C-I, D-II
View Solution

Question 198:

Choose the correct statement given below regarding juxta medullary nephron:

  • (1) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
  • (2) Loop of Henle of juxta medullary nephron runs deep into medulla.
  • (3) Juxta medullary nephrons outnumber the cortical nephrons.
  • (4) Juxta medullary nephrons are located in the columns of Bertini.
Correct Answer: (2) Loop of Henle of juxta medullary nephron runs deep into medulla.
View Solution

Question 199:

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:


  • (1) B only
  • (2) C \& B only
  • (3) D \& E only
  • (4) A only
Correct Answer: (4) A only
View Solution

Question 200:

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

Choose the most appropriate answer from the options given below:

  • (1) A, B & D only
  • (2) B, D & E only
  • (3) B, C & D only
  • (4) A & C only
Correct Answer: (2) B, D & E only
View Solution



NEET Previous Year Question Papers with Answer Keys

Other UG Entrance Exams