NEET 2024 Question Paper with Answers and Solutions PDF Q4 in English

A thin spherical shell is charged by some source. The potential difference between the two points \( C \) and \( P \) (in V) shown in the figure is:
(Take \( \frac{1}{4 \pi \varepsilon_0} = 9 \times 10^9 \) SI units)

• (1) \( 3 \times 10^5 \)
• (2) \( 1 \times 10^5 \)
• (3) \( 0.5 \times 10^5 \)
• (4) Zero

The output \( Y \) of the given logic gate is similar to the output of a/an:

• (1) NAND gate
• (2) NOR gate
• (3) OR gate
• (4) AND gate

If the monochromatic source in Young’s double-slit experiment is replaced by white light, then:

• (1) Interference pattern will disappear
• (2) There will be a central dark fringe surrounded by a few colored fringes
• (3) There will be a central bright white fringe surrounded by a few colored fringes
• (4) All bright fringes will be of equal width

In a vernier caliper, \( (N + 1) \) divisions of the vernier scale coincide with \( N \) divisions of the main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:

• (1) \( \frac{1}{10N} \)
• (2) \( \frac{1}{100(N+1)} \)
• (3) \( 100N \)
• (4) \( 10(N+1) \)

The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus, respectively, are \( 8 \times 10^8 \) N/m\(^2\) and \( 2 \times 10^{11} \) N/m\(^2\), is:

• (1) 4 mm
• (2) 0.4 mm
• (3) 40 mm
• (4) 8 mm

The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is
2400 g \(cm^2\). The length of the 400 g rod is nearly:

• (1) \( 8.5 \) cm
• (2) \( 17.5 \) cm
• (3) \( 20.7 \) cm
• (4) \( 72.0 \) cm

A tightly wound 100-turn coil of radius 10 cm carries a current of 7 A. The magnetic field at the center of the coil is:

(Take permeability of free space as \(4 \pi * 10^–^7\) SI units)

• (1) \( 44 \) mT
• (2) \( 4.4 \) T
• (3) \( 4.4 \) mT
• (4) \( 44 \) T

At any instant of time t, the displacement of any particle is given by \( 2t – 1 \) (SI unit) under the influence of force
of 5 N. The value of instantaneous power is (in SI unit):

• (1) \( 10 \)
• (2) \( 5 \)
• (3) \( 7 \)
• (4) \( 6 \)

Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity v1 while body B is at rest before collision. The velocity of the system after collision is v2. The ratio v1 : v2 is

• (1) \( 1:2 \)
• (2) \( 2:1 \)
• (3) \( 4:1 \)
• (4) \( 1:4 \)

A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is :

• (1) \( 0 \)
• (2) \( 4 \) N
• (3) \( 6 \) N
• (4) \( 10 \) N

The mass of a planet is \( \frac{1}{10} \) that of the earth and its radius is \( \frac{1}{2} \) that of the earth. The acceleration due to gravity on the planet is:

• (1) \( 19.6 m/s^2 \)
• (2) \( 9.8 m/s^2 \)
• (3) \( 4.9 m/s^2 \)
• (4) \( 3.92 m/s^2 \)

Consider the following statements A and B and choose the correct option:


A: For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.

B: In a reverse biased pn junction diode, the current measured in \(\mu A\), is due to majority charge carriers.

• (1) A is correct but B is incorrect.
• (2) A is incorrect but B is correct.
• (3) Both A and B are correct.
• (4) Both A and B are incorrect.

A light ray enters through a right angled prism at point P with the angle of incidence 30 degree as shown in figure. It
travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the
prism is:

• (1) \( \frac{\sqrt{5}}{4} \)
• (2) \( \frac{\sqrt{5}}{2} \)
• (3) \( \frac{\sqrt{3}}{4} \)
• (4) \( \frac{\sqrt{3}}{2} \)

Given below are two statements:

Statement I: Atoms are electrically neutral as they contain an equal number of positive and negative charges.

Statement II: Atoms of each element are stable and emit their characteristic spectrum.

In the light of the above statements, choose the most appropriate answer from the options given below.

• (1) Both Statement I and Statement II are correct
• (2) Both Statement I and Statement II are incorrect
• (3) Statement I is correct but Statement II is incorrect
• (4) Statement I is incorrect but Statement II is correct

A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 N \(m^–^1\), then the excess force required to take it away from the surface is

• (1) \( 19.8 \) mN
• (2) \( 198 \) N
• (3) \( 1.98 \) mN
• (4) \( 99 \) N

In the given diagram, a strong bar magnet is moved through a loop. The direction of induced current is:

• (1) AB and DC
• (2) BA and CD
• (3) AB and CD
• (4) BA and DC

A particle moving with uniform speed in a circular path has:

• (1) Constant velocity
• (2) Constant acceleration
• (3) Constant velocity but varying acceleration
• (4) Varying velocity and varying acceleration

Match List I with List II.

• (1) A-II, B-I, C-IV, D-III
• (2) A-III, B-IV, C-II, D-I
• (3) A-IV, B-III, C-I, D-II
• (4) A-I, B-II, C-III, D-IV

The quantities which have the same dimensions as those of solid angle are:

• (1) Strain and angle
• (2) Stress and angle
• (3) Strain and arc
• (4) Angular speed and stress

An unpolarized light beam strikes a glass surface at Brewster’s angle. Then

• (1) The reflected light will be partially polarized.
• (2) The refracted light will be completely polarized.
• (3) Both the reflected and refracted light will be partially polarized.
• (4) The reflected light will be completely polarized.

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole moment vector \( \vec{P} \) of magnitude, \( 4 \times 10^{-6} \, C m \), is \( \pm 9 \times 10^3 \, V. \)

(Take \( \frac{1}{4\pi \epsilon_0} = 9 \times 10^9 \, SI units \))

Reason R: \( V = \pm \frac{2P}{4\pi \epsilon_0 r^2} \), where \( r \) is the distance of any axial point, situated at 2 m from the centre of the dipole.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
  (2) Both A and R are true and R is NOT the correct explanation of A.
  (3) A is true but R is false.
  (4) A is false but R is true.

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \( v \) in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)?

• (A) Point \( P \) moves faster than point \( Q \)
• (B) Both the points \( P \) and \( Q \) move with equal speed
• (C) Point \( P \) has zero speed
• (D) Point \( P \) moves slower than point \( Q \)

If \( x = 5 \sin(\pi t + \frac{\pi}{3}) \) represents the motion of a particle, find the amplitude and time period of the motion.

• (1) \( 5 \, cm, \, 2 \, s \)
• (2) \( 5 \, m, \, 2 \, s \)
• (3) \( 5 \, cm, \, 1 \, s \)
• (4) \( 5 \, m, \, 1 \, s \)

A logic circuit provides the output \( Y \) as per the truth table given below. Identify the circuit.

• (A) \( A \overline{B} + \overline{A} \)
• (B) \( A \overline{B} + \overline{A} \)
• (C) \( \overline{B} \)
• (D) \( B \)

If \( c \) is the velocity of light in free space, the correct statements about photons are:

A: The energy of a photon is \( E = h\nu \).

B: The velocity of a photon is \( c \).

C: The momentum of a photon, \( p = \frac{h\nu}{c} \).

D: In a photon-electron collision, both total energy and total momentum are conserved.

E: Photon possesses positive charge.

• (A) A and B only
• (B) A, B, C and D only
• (C) A, C and D only
• (D) A, B, D and E only

A bob is whirled in a horizontal plane by means of a string with an initial speed of \( \omega \) rpm. The tension in the string is T. If speed becomes 2\( \omega \) while keeping the same radius, the tension in the string becomes:

• (1) \( T \)
• (2) \( 4T \)
• (3) \( \frac{T}{4} \)
• (4) \( \sqrt{2}T \)

The terminal voltage of the battery, whose emf is 10 V and internal resistance \( 1 \, \Omega \), when connected through
an external resistance of \( 4 \, \Omega \) as shown in the figure is:

• (1) \( 4 \, V \)
• (2) \( 6 \, V \)
• (3) \( 8 \, V \)
• (4) \( 10 \, V \)

In a uniform magnetic field of \( 0.049 \, T \), a magnetic dipole is placed with a dipole moment of \( 5 \, A \cdot m^2 \). Calculate the torque acting on it if the angle between the dipole moment and magnetic field is \( 30^\circ \).

• (1) \( 5\pi^2 \)
• (2) \( 128\pi^2 \)
• (3) \( 50\pi^2 \)
• (4) \( 1280\pi^2 \)

A wire of length \( l \) and resistance \( 100 \, \Omega \) is divided into 10 equal parts. The first 5 parts are connected in series
while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

• (1) \( 26 \, \Omega \)
• (2) \( 52 \, \Omega \)
• (3) \( 55 \, \Omega \)
• (4) \( 60 \, \Omega \)

Match List-I with List-II:

• (1) A-II, B-III, C-IV, D-I
• (2) A-II, B-I, C-III, D-IV
• (3) A-III, B-II, C-I, D-IV
• (4) A-IV, B-III, C-II, D-I

In the nuclear emission stated above, the mass number and atomic number of the resulting nucleus will be:

• (1) \( 280, \, 81 \)
• (2) \( 286, \, 80 \)
• (3) \( 288, \, 82 \)
• (4) \( 286, \, 81 \)

The graph which shows the variation of \( \frac{1}{\lambda^2} \) with stopping potential \( V \) for a photoelectric experiment is:

Correct Answer: (4)
View Solution

In an ideal transformer, the turns ratio is \( \frac{N_p}{N_s} = \frac{1}{2} \). The ratio VS : VP is equal to (the symbols carry their usual
meaning) :

• (1) \(1 : 2\)
• (2) \( 2 : 1 \)
• (3) \( 1 : 1 \)
• (4) \(1 : 4 \)

A thermodynamic system is taken through the cycle \( abcda \), where \( ab \) is isochoric, \( bc \) is isobaric, \( cd \) is isothermal, and \( da \) is adiabatic. What is the work done during the complete cycle?

• (1) Zero
• (2) \( 30 \, J \)
• (3) \( -90 \, J \)
• (4) \( -60 \, J \)

In the following circuit, the equivalent capacitance between points \( A \) and \( B \) is:

• (1) \( 2 \, \muF \)
• (2) \( 1 \, \muF \)
• (3) \( 0.5 \, \muF \)
• (4) \( 4 \, \muF \)

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, the

A. the charge stored in it, increases.

B. the energy stored in it, decreases.

C. its capacitance increases.

D. the ratio of charge to its potential remains the same.

E. the product of charge and voltage increases.

Choose the most appropriate answer from the options given below:

• (1) \( A, B and E only \)
• (2) \( A, C and E only \)
• (3) \( B, D and E only \)
• (4) \( A, B and C only \)

A \( 10 \, \muF \) capacitor is connected to a \( 210 \, V, \, 50 \, Hz \) AC supply. What is the peak current in the circuit?

• (1) \( 0.58 \, A \)
• (2) \( 0.93 \, A \)
• (3) \( 1.20 \, A \)
• (4) \( 0.35 \, A \)

A force defined by \( F = \alpha t^2 + \beta t \) acts on a particle. What is the dimension of the ratio \( \frac{\alpha t}{\beta} \)?

• (1) \( \frac{\beta}{\alpha} \)
• (2) \( \frac{\alpha t}{\beta} \)
• (3) \( \alpha \beta t \)
• (4) \( \frac{\alpha \beta}{t} \)

The following graph represents the \( T-V \) curves of a thermodynamic process for three different pressures \( P_1, P_2, P_3 \). Arrange the pressures in increasing order.

• (1) \( P_3 > P_2 > P_1 \)
• (2) \( P_1 > P_3 > P_2 \)
• (3) \( P_2 > P_1 > P_3 \)
• (4) \( P_1 > P_2 > P_3 \)

An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms
make an angle 60degree with each other. The magnetic moment of this new magnet is :

• (1) \( M \)
• (2) \( \frac{M}{2} \)
• (3) \( 2M \)
• (4) \( \frac{M}{\sqrt{3}} \)

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If \( I \) is the current in the circuit, then in the gap between the plates:

• (1) There is no current
• (2) Displacement current of magnitude equal to \( I \) flows in the same direction as \( I \)
• (3) Displacement current of magnitude equal to \( I \) flows in a direction opposite to that of \( I \)
• (4) Displacement current of magnitude greater than \( I \) flows but can be in any direction

A metallic bar of Young's modulus, \( 0.5 \times 10^{11} \, N/m^2 \), and coefficient of linear thermal expansion \( 10^{-5} \, °C^{-1} \), length 1 m and area of cross-section \( 10^{-3} \, m^2 \), is heated from \( 0 \, °C \) to \( 100 \, °C \) without expansion or bending. The compressive force developed in it is:

• (1) \( 5 \times 10^3 \, N \)
• (2) \( 50 \times 10^3 \, N \)
• (3) \( 100 \times 10^3 \, N \)
• (4) \( 2 \times 10^3 \, N \)

Choose the correct circuit which can achieve the bridge balance.

The velocity \( v \) – time \( t \) plot of the motion of a body is shown below:



The acceleration \( a \) – time \( t \) graph that best suits this motion is:

A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of the telescope for viewing a distant object is:

• (1) 34
• (2) 28
• (3) 17
• (4) 32

The minimum energy required to launch a satellite of mass \( m \) from the surface of Earth of mass \( M \) and radius \( R \) in a circular orbit at an altitude of \( 2R \) from the surface of the Earth is:

• (1) \( \frac{5 GmM}{6R} \)
• (2) \( \frac{2 GmM}{3R} \)
• (3) \( \frac{GmM}{2R} \)
• (4) \( \frac{GmM}{3R} \)

If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is \( \frac{x}{2} \) times its original time period. Then the value of \( x \) is:

• (1) \( \sqrt{3} \)
• (2) \( \sqrt{2}\)
• (3) \( 2 \sqrt{3} \)
• (4) 4

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:

(A) Hold the sheet there if it is magnetic.

(B) Hold the sheet there if it is non-magnetic.

(C) Move the sheet away from the pole with uniform velocity if it is conducting.

(D) Move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.


Choose the correct statement(s) from the options given below:

• (1) B and D only
• (2) A and C only
• (3) A, C and D only
• (4) C only

Two heaters A and B have power ratings of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

• (1) \( 1 : 1 \)
• (2) \( 2 : 9 \)
• (3) \( 1 : 2 \)
• (4) \( 2 : 3 \)

The property which is not of an electromagnetic wave travelling in free space is that:

• (1) They are transverse in nature
• (2) The energy density in electric field is equal to energy density in magnetic field
• (3) They travel with a speed equal to \( \frac{1}{\sqrt{\mu_0 \varepsilon_0}} \)
• (4) They originate from charges moving with uniform speed

Among Group 16 elements, which one does NOT show -2 oxidation state?

• (1) O
• (2) Se
• (3) Te
• (4) Po

Match List I with List II.

• (1) A-I, B-IV, C-II, D-III
• (2) A-IV, B-III, C-I, D-I
• (3) A-III, B-IV, C-II, D-I
• (4) A-III, B-IV, C-I, D-II

Fehling's solution 'A' is:

• (1) aqueous copper sulphate
• (2) alkaline copper sulphate
• (3) alkaline solution of sodium potassium tartrate (Rochelle's salt)
• (4) aqueous sodium citrate

Match List I with List II.




Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-III, B-IV, C-I, D-II
• (3) A-II, B-III, C-I, D-IV
• (4) A-III, B-IV, C-II, D-I

Identify the correct reagents that would bring about the following transformation.

• (1) (i) H\(_2\)O/H\(^+\), (ii) CrO\(_3\)
• (2) (i) BH\(_3\), (ii) H\(_2\)O\(_2\)/OH, ( iii) PCC
• (3) (i) BH\(_3\), (ii) H\(_2\)O\(_2\)/OH, (iii) alk.KMnO\(_4\), (iv) H\(_3\)O\(^+\)
• (4) (i) H\(_2\)O/H\(^+\), (ii) PCC

Intramolecular hydrogen bonding is present in:

Activation energy of any chemical reaction can be calculated if one knows the value of:

• (1) rate constant at standard temperature
• (2) probability of collision
• (3) orientation of reactant molecules during collision
• (4) rate constant at two different temperatures

Match List I with List II:

• (1) A-II, B-III, C-IV, D-I
• (2) A-I, B-III, C-IV, D-II
• (3) A-I, B-IV, C-III, D-II
• (4) A-II, B-IV, C-III, D-I

1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to:

• (1) 750 mg
• (2) 250 mg
• (3) Zero mg
• (4) 200 mg

Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si

• (1) \(Si < C < N < O < F\)
• (2) \(Si < C < O < N < F\)
• (3) \(O < F < N < C < Si\)
• (4) \(F < O < N < C < Si\)

Match List I with List II.

• (1) A-IV, B-III, C-II, D-I
• (2) A-IV, B-II, C-III, D-I
• (3) A-I, B-II, C-III, D-IV
• (4) A-II, B-III, C-IV, D-I

Which one of the following alcohols reacts instantaneously with Lucas reagent?

Correct Answer:
View Solution

The energy of an electron in the ground state (\(n = 1\)) for He\(^+\) ion is \( -x \) J, then that for an electron in \( n = 2 \) state for Be\(^3+\) ion in J is:

• (1) \( -x \)
• (2) \( -\frac{x}{9} \)
• (3) \( -4x \)
• (4) \( -\frac{4x}{9} \)

The compound that will undergo SN1 reaction with the fastest rate is:

Correct Answer:
View Solution

The Henry's law constant (K\(_H\)) values of three gases (A, B, C) in water are 145, \(2 \times 10^{-5}\), and 35 kbar, respectively. The solubility of these gases in water follow the order:

• (1) \(B > A > C\)
• (2) \(B > C > A\)
• (3) \(A > C > B\)
• (4) \( A > B > C\)

Which plot of \( \ln k \) vs \( \frac{1}{T} \) is consistent with the Arrhenius equation?

Correct Answer:
View Solution

In which of the following equilibria, \( K_p \) and \( K_c \) are NOT equal?

• (1) \(PCl_5(g) \rightleftharpoons PCl_3(g) + Cl_2(g)\)
• (2) \( H_2(g) + I_2(g) \rightleftharpoons 2HI(g) \)
• (3) \( CO(g) + H_2O(g) \rightleftharpoons CO_2(g) + H_2(g) \)
• (4) \( 2BrCl(g) \rightleftharpoons Br_2(g) + Cl_2(g) \)

Given below are two statements:
Statement I: The boiling point of three isomeric pentanes follows the order \[ n-pentane > isopentane > neopentane \]
Statement II: When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.

In light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct
• (2) Both Statement I and Statement II are incorrect
• (3) Statement I is correct but Statement II is incorrect
• (4) Statement I is incorrect but Statement II is correct

The reagents with which glucose does not react to give the corresponding tests/products are:

A. Tollen’s reagent

B. Schiff’s reagent

C. HCN

D. NH2OH

E. NaHSO3

Choose the correct options from the given below:

• (1) B and C
• (2) A and D
• (3) B and D
• (4) E and D

In which of the following processes entropy increases?


(A) A liquid evaporates to vapour


(B) Temperature of a crystalline solid lowered from 130 K to 0 K.


(C) \( 2NaHCO_3(s) \rightarrow Na_2CO_3(s) + CO_2(g) + H_2O(g) \)


(D) \( Cl_2(g) \rightarrow 2Cl(g) \)

Choose the correct answer from the options given below:

• (1) A and C
• (2) A, B and D
• (3) A, C and D
• (4) C and D

Match List I with List II.




Choose the correct answer from the options given below:

• (1) A-IV, B-I, C-III, D-II
• (2) A-III, B-I, C-II, D-IV
• (3) A-IV, B-I, C-II, D-III
• (4) A-I, B-IV, C-II, D-III

Given below are two statements:
Statement I: The boiling point of hydrides of Group 16 elements follows the order \[ H_2O > H_2Te > H_2Se > H_2S \]
Statement II: On the basis of molecular mass, H\(_2\)O is expected to have lower boiling point than the other members of the group but due to the presence of extensive H-bonding in H\(_2\)O, it has higher boiling point.

In light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are TRUE
• (2) Both Statement I and Statement II are false
• (3) Statement I is correct but Statement II is FALSE
• (4) Statement I is incorrect but Statement II is TRUE

For the reaction \( 2A \rightleftharpoons B + C \), \( K_c = 4 \times 10^{-3} \). At a given time, the composition of reaction mixture is: \[ [A] = [B] = [C] = 2 \times 10^{-3} \, M \]
Then, which of the following is correct?

• (1) Reaction is at equilibrium.
• (2) Reaction has a tendency to go in forward direction.
• (3) Reaction has a tendency to go in backward direction.
• (4) Reaction has gone to completion in forward direction.

Match List I with List II.

• (1) A-I, B-III, C-II, D-IV
• (2) A-III, B-IV, C-I, D-II
• (3) A-III, B-IV, C-II, D-I
• (4) A-II, B-I, C-IV, D-III

A compound with a molecular formula of C\(_6\)H\(_1_4\) has two tertiary carbons. Its IUPAC name is:

• (1) n-hexane
• (2) 2-methylpentane
• (3) 2,3-dimethylbutane
• (4) 2,2-dimethylbutane

On heating, some solid substances change from solid to vapor state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as:

• (1) Crystallization
• (2) Sublimation
• (3) Distillation
• (4) Chromatography

The most stable carbocation among the following is:

Correct Answer:
View Solution

Given below are two statements:
Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.
Statement II: Aniline cannot be prepared through Gabriel synthesis.

In light of the above statements, choose the correct answer from the options given below:

• (1) Both statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is correct but Statement II is false
• (4) Statement I is incorrect but Statement II is true

Which reaction is NOT a redox reaction?

• (1) \( Zn + CuSO_4 \rightarrow ZnSO_4 + Cu \)
• (2) \( 2KClO_3 \rightarrow 2KCl + Cl_2 \)
• (3) \( H_2 + Cl_2 \rightarrow 2HCl \)
• (4) \( BaCl_2 + Na_2SO_4 \rightarrow BaSO_4 + 2NaCl \)

Match List I with List II.

• (1) A-I, B-IV, C-II, D-III
• (2) A-II, B-IV, C-III, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-III, C-IV, D-I

Arrange the following elements in increasing order of first ionization enthalpy:
Li, Be, B, C, N

• (1) \(Li < Be < B < C < N\)
• (2) \(Li < B < Be < C < N\)
• (3) \(Li < Be < C < B < N\)
• (4) \(Li < Be < N < C < B\)

'Spin only' magnetic moment is same for which of the following ions?

A. Ti\(^{3+}\)

B. Cr\(^{2+}\)

C. Mn\(^{2+}\)

D. Fe\(^{2+}\)

E. Sc\(^{3+}\)

Choose the most appropriate answer from the options given below.

• (1) B and D only
• (2) A and E only
• (3) B and C only
• (4) A and D only

The \(E^\circ\) value for the Mn\(^{3+}\)/Mn\(^{2+}\) couple is more positive than that of Cr\(^{3+}\)/Cr\(^{2+}\) or Fe\(^{3+}\)/Fe\(^{2+}\) due to change of:

• (1) d\(^5\) to d\(^4\) configuration
• (2) d\(^5\) to d\(^2\) configuration
• (3) d\(^4\) to d\(^5\) configuration
• (4) d\(^3\) to d\(^5\) configuration

The highest number of helium atoms is in:

• (1) 4 mol of helium
• (2) 4 u of helium
• (3) 3 g of helium
• (4) 2.271098 L of helium at STP

Given below are two statements:

Statement I: Both [Co(NH\(_3\))\(_6\)]\(^{3+}\) and [CoF\(_6\)]\(^{3-}\) complexes are octahedral but differ in their magnetic behaviour.
Statement II: [Co(NH\(_3\))\(_6\)]\(^{3+}\) is diamagnetic whereas [CoF\(_6\)]\(^{3-}\) is paramagnetic.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are correct
• (2) Both Statement I and Statement II are incorrect
• (3) Statement I is correct but Statement II is false
• (4) Statement I is false but Statement II is correct

The pair of lanthanoid ions which are diamagnetic is:

• (1) Ce\(^{4+}\) and Yb\(^{2+}\)
• (2) Ce\(^{3+}\) and Eu\(^{2+}\)
• (3) Gd\(^{3+}\) and Eu\(^{3+}\)
• (4) Pm\(^{3+}\) and Sm\(^{3+}\)

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.

A. Al\(^{3+}\)

B. Cu\(^{2+}\)

C. Ba\(^{2+}\)

D. Co\(^{2+}\)

E. Mg\(^{2+}\)

Choose the correct answer from the options given below:

• (1) B, A, D, C, E
• (2) B, C, A, D, E
• (3) E, C, D, B, A
• (4) E, A, B, C, D

Major products A and B formed in the following reaction sequence, are:

Correct Answer:
View Solution

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is:
(Given R = 2.0 cal K\(^{-1}\) mol\(^{-1}\))

• (1) 0 calorie
• (2) -413.14 calories
• (3) 413.14 calories
• (4) 100 calories

Identify the major product C formed in the following reaction sequence:

• (1) propylamine
• (2) butylamine
• (3) butanamide
• (4) \(\alpha\)-bromobutanoic acid

The products A and B obtained in the following reactions, respectively, are \[ 3ROH + PCl_3 \rightarrow 3RCl + A \] \[ ROH + PCl_5 \rightarrow RCl + HCl + B \]

• (1) POCl\(_3\) and H\(_3\)PO\(_3\)
• (2) POCl\(_3\) and H\(_3\)PO\(_4\)
• (3) H\(_3\)PO\(_4\) and POCl\(_3\)
• (4) H\(_3\)PO\(_3\) and POCl\(_3\)

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given: Molar mass of Cu = 63 g mol\(^{-1}\), 1 F = 96487 C)

• (1) 3.15 g
• (2) 0.315 g
• (3) 31.5 g
• (4) 0.0315 g

A compound X contains 32% of A, 20% of B and the remaining percentage of C. Then, the empirical formula of X is:
(Given atomic masses of A = 64, B = 40, C = 32 u)

• (1) A\(_2\)BC\(_2\)
• (2) ABC\(_3\)
• (3) AB\(_2\)C\(_2\)
• (4) ABC\(_4\)

During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe\(^{2+}\) ion?

• (1) dilute hydrochloric acid
• (2) concentrated sulphuric acid
• (3) dilute nitric acid
• (4) dilute sulphuric acid

Identify the correct answer.

• (1) Three resonance structures can be drawn for ozone.
• (2) BF\(_3\) has non-zero dipole moment.
• (3) Dipole moment of NF\(_3\) is greater than that of NH\(_3\).
• (4) Three canonical forms can be drawn for CO\(_3^{2-}\) ion.

The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation.
Given \( R = 8.314 \, J K^{-1} mol^{-1} \), \( \log 4 = 0.6021 \)

• (1) 38.04 kJ/mol
• (2) 380.4 kJ/mol
• (3) 3.80 kJ/mol
• (4) 3804 kJ/mol

For the given reaction:

Correct Answer:
View Solution

The plot of osmotic pressure (\(\Pi\)) vs concentration (mol L\(^{-1}\)) for a solution gives a straight line with slope 25.73 L bar mol\(^{-1}\). The temperature at which the osmotic pressure measurement is done is
(Use \( R = 0.083 \, L bar mol^{-1} K^{-1} \))

• (1) 37°C
• (2) 310°C
• (3) 25.73°C
• (4) 12.05°C

Given below are two statements:

Statement I: \([Co(NH_3)_6]^{3+}\) is a homoleptic complex whereas \([Co(NH_3)_4Cl_2]^+\) is a heteroleptic complex.

Statement II: Complex \([Co(NH_3)_6]^{3+}\) has only one kind of ligands but \([Co(NH_3)_4Cl_2]^+\) has more than one kind of ligands.


In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Consider the following reaction in a sealed vessel at equilibrium with concentrations of \[ N_2 = 3.0 \times 10^{-3} \, M, \, O_2 = 4.2 \times 10^{-3} \, M \, and \, NO = 2.8 \times 10^{-3} \, M. \] \[ 2NO(g) \rightleftharpoons N_2(g) + O_2(g) \]
If 0.1 mol L\(^{-1}\) of NO(g) is taken in a closed vessel, what will be degree of dissociation (\(\alpha\)) of NO(g) at equilibrium?

• (1) 0.00889
• (2) 0.0889
• (3) 0.8889
• (4) 0.717

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin:

• (1) promotes apical dominance.
• (2) promotes abscission of mature leaves only.
• (3) does not affect mature monocotyledonous plants.
• (4) can help in cell division in grasses, to produce growth.

How many molecules of ATP and NADPH are required for every molecule of CO\(_2\) fixed in the Calvin cycle?

• (1) 2 molecules of ATP and 3 molecules of NADPH
• (2) 2 molecules of ATP and 2 molecules of NADPH
• (3) 3 molecules of ATP and 3 molecules of NADPH
• (4) 3 molecules of ATP and 2 molecules of NADPH

In the given figure, which component has thin outer walls and highly thickened inner walls?

• (1) C
• (2) D
• (3) A
• (4) B

Match List I with List II





Choose the correct answer from the options given below:

• (1) A-III, B-II, C-IV, D-I
• (2) A-II, B-III, C-I, D-IV
• (3) A-III, B-IV, C-II, D-I
• (4) A-I, B-II, C-III, D-IV

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

• (1) (a) Epigynous; (b) Hypogynous
• (2) (a) Hypogynous; (b) Epigynous
• (3) (a) Perigynous; (b) Epigynous
• (4) (a) Perigynous; (b) Perigynous

Match List I with List II


Choose the correct answer from the options given below:

• (1) A-III, B-II, C-IV, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-III, B-II, C-I, D-IV
• (4) A-IV, B-III, C-II, D-I

Which of the following is an example of actinomorphic flower?

• (1) Datura
• (2) Cassia
• (3) Pisum
• (4) Sesbania

Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.

B. The flowers of water lily are not pollinated by water.

C. In most of water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon-like.

E. In some hydrophytes, the pollen grains are carried passively inside water.


Choose the correct answer from the options given below:

• (1) C, D and E only
• (2) A, B, C and D only
• (3) A, C, D and E only
• (4) B, C, D and E only

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

• (1) Only red flowered plants
• (2) Red flowered as well as pink flowered plants
• (3) Only pink flowered plants
• (4) Red, Pink as well as white flowered plants

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

• (1) Differentiation
• (2) Redifferentiation
• (3) Dedifferentiation
• (4) Maturation

Match List I with List II





Choose the correct answer from the options given below:

• (1) A-I, B-II, C-III, D-IV
• (2) A-II, B-I, C-III, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-II, D-I

Which of the following are required for the dark reaction of photosynthesis?
A. Light

B. Chlorophyll

C. CO\(_2\)

D. ATP

E. NADPH


Choose the correct answer from the options given below:

• (1) A, B and C only
• (2) B, C and D only
• (3) C, D and E only
• (4) D and E only

Given below are two statements:
Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.
Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Spindle fibers attach to kinetochores of chromosomes during

• (1) Prophase
• (2) Metaphase
• (3) Anaphase
• (4) Telophase

What is the fate of a piece of DNA carrying only the gene of interest which is transferred into an alien organism?

A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.

B. It may get integrated into the genome of the recipient.

C. It may multiply and be inherited along with the host DNA.

D. The alien piece of DNA is not an integral part of the chromosome.

E. It shows ability to replicate.


Choose the correct answer from the options given below:

• (1) A and B only
• (2) D and E only
• (3) B and C only
• (4) A and E only

The lactose present in the growth medium of bacteria is transported to the cell by the action of

• (1) Beta-galactosidase
• (2) Acetylase
• (3) Permease
• (4) Polymerase

Given below are two statements:
Statement I: Parenchyma is living but collenchyma is dead tissue.
Statement II: Gymnosperms lack xylem vessels but the presence of xylem vessels is the characteristic of angiosperms.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Which one of the following is not a criterion for classification of fungi?

• (1) Morphology of mycelium
• (2) Mode of nutrition
• (3) Mode of spore formation
• (4) Fruiting body

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

• (1) BB
• (2) bb
• (3) Bb
• (4) BB/Bb

Tropical regions show the greatest level of species richness because
A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.

B. Tropical environments are more seasonal.

C. More solar energy is available in tropics.

D. Constant environments promote niche specialization.

E. Tropical environments are constant and predictable.


Choose the correct answer from the options given below.

• (1) A, C, D and E only
• (2) A and B only
• (3) A, B and E only
• (4) A, B and D only

These are regarded as major causes of biodiversity loss:
A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration

Choose the correct option:

• (1) A, C and D only
• (2) A, B, C and D only
• (3) A, B and E only
• (4) A, B and D only

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end:

• (1) Repressor, Operator gene, Structural gene
• (2) Structural gene, Transposons, Operator gene
• (3) Inducer, Repressor, Structural gene
• (4) Promotor, Structural gene, Terminator

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

• (1) 8 bp
• (2) 6 bp
• (3) 4 bp
• (4) 10 bp

The cofactor of the enzyme carboxypeptidase is:

• (1) Zinc
• (2) Niacin
• (3) Flavin
• (4) Haem

Match List I with List II





Choose the correct answer from the options given below:

• (1) A-III, B-I, C-II, D-IV
• (2) A-II, B-IV, C-III, D-I
• (3) A-III, B-I, C-IV, D-II
• (4) A-IV, B-I, C-III, D-II

List of endangered species was released by:

• (1) GEAC
• (2) WWF
• (3) FOAM
• (4) IUCN

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called:

• (1) in-situ conservation
• (2) Biodiversity conservation
• (3) Semi-conservative method
• (4) Sustainable development

The capacity to generate a whole plant from any cell of the plant is called:

• (1) Totipotency
• (2) Micropropagation
• (3) Differentiation
• (4) Somatic hybridization

From this equation, K indicates:

• (1) Intrinsic rate of natural increase
• (2) Biotic potential
• (3) Carrying capacity
• (4) Population density

Bulliform cells are responsible for:

• (1) Inward curling of leaves in monocots.
• (2) Protecting the plant from salt stress.
• (3) Increased photosynthesis in monocots.
• (4) Providing large spaces for storage of sugars.

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

• (1) Amino acids
• (2) Phospholipids
• (3) Glycerides
• (4) Carbohydrates

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

• (1) Cofactor inhibition
• (2) Feedback inhibition
• (3) Competitive inhibition
• (4) Enzyme activation

Given below are two statements:

Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.

Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect, the inactive protoxin gets converted into active form due to the acidic pH of the insect gut.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.





Choose the correct answer from the options given below:

• (1) A
• (2) B
• (3) C
• (4) D

Which one of the following can be explained on the basis of Mendel's Law of Dominance?

A. Out of one pair of factors one is dominant and the other is recessive.

B. Alleles do not show any expression and both the characters appear as such in F2 generation.

C. Factors occur in pairs in normal diploid plants.

D. The discrete unit controlling a particular character is called factor.

E. The expression of only one of the parental characters is found in a monohybrid cross.

Choose the correct answer from the options given below:

• (1) A, B and C only
• (2) A, C, D and E only
• (3) B, C and D only
• (4) A, B, C, D and E

Match List I with List II


Choose the correct answer from the options given below:

• (1) A-I, B-II, C-III, D-IV
• (2) A-II, B-I, C-IV, D-III
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-II, D-I

Match List I with List II


Choose the correct answer from the options given below:

• (1) A-II, B-III, C-I, D-IV
• (2) A-III, B-I, C-IV, D-II
• (3) A-I, B-III, C-II, D-IV
• (4) A-III, B-IV, C-II, D-I

In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is \(100x \, kcal m^{-2} yr^{-1}\), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

• (1) \( \frac{x}{10} \, (kcal m^{-2} yr^{-1})\)
• (2) \(x \, (kcal m^{-2} yr^{-1})\)
• (3) \(10x \, (kcal m^{-2} yr^{-1})\)
• (4) \(100x/3X \, (kcal m^{-2} yr^{-1})\)

Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

A. Asexual reproduction occurs usually by biflagellate zoospores.

B. Sexual reproduction is by oogamous method only.

C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.

D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.

E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.

Choose the correct answer from the options given below:

• (1) A, B, C and D only
• (2) B, C, D and E only
• (3) A, C, D and E only
• (4) A, B, C and E only

Spraying sugarcane crop with which of the following plant growth regulators increases the length of stem, thus increasing the yield?

• (1) Auxin
• (2) Gibberellin
• (3) Cytokinin
• (4) Abscisic acid

Match List I with List II





Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-I, D-III
• (2) A-IV, B-I, C-II, D-III
• (3) A-I, B-II, C-IV, D-III
• (4) A-III, B-I, C-IV, D-II

Which of the following statement is correct regarding the process of replication in E.coli?

• (1) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’ → 5’
• (2) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5’ → 3’
• (3) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ as well as 3’ → 5’ direction
• (4) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

• (1) Malic acid → Oxaloacetic acid
• (2) Succinic acid → Malic acid
• (3) Succinyl-CoA → Succinic acid
• (4) Isocitrate → \alpha-ketoglutaric acid

Match List I with List II





Choose the correct answer from the options given below:

• (1) A-III, B-II, C-I, D-IV
• (2) A-III, B-IV, C-I, D-II
• (3) A-II, B-III, C-IV, D-I
• (4) A-IV, B-I, C-II, D-III

Identify the correct description about the given figure:

• (1) Wind pollinated plant inflorescence showing flowers with well exposed stamens.
• (2) Water pollinated flowers showing stamens with mucilaginous covering.
• (3) Cleistogamous flowers showing autogamy.
• (4) Compact inflorescence showing complete autogamy

The DNA present in chloroplast is:

• (1) Linear, double stranded
• (2) Circular, double stranded
• (3) Linear, single stranded
• (4) Circular, single stranded

Given below are two statements:

Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.

Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Match List-I with List-II





Choose the correct answer from the options given below:

• (1) A-IV, B-I, C-II, D-III
• (2) A-I, B-II, C-III, D-IV
• (3) A-II, B-III, C-IV, D-I
• (4) A-III, B-IV, C-I, D-II

Match List I with List II





Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-I, B-II, C-III, D-IV
• (3) A-IV, B-III, C-II, D-I
• (4) A-II, B-III, C-IV, D-I

Which of the following are fused in somatic hybridization involving two varieties of plants?

• (1) Callus
• (2) Somatic embryos
• (3) Protoplasts
• (4) Pollens

Match List I with List II


Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-II, B-I, C-IV, D-III
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-III, C-II, D-I

Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below:

• (1) C-E-D-A-B
• (2) E-B-D-A-C
• (3) B-D-E-A-C
• (4) E-C-A-D-B

Match List I with List II:





Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-III, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-III, B-I, C-II, D-IV
• (4) A-IV, B-II, C-III, D-I

Match List I with List II:





Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-IV, B-III, C-I, D-II
• (3) A-III, B-I, C-IV, D-II
• (4) A-II, B-IV, C-III, D-I

The flippers of the Penguins and Dolphins are an example of:

• (1) Adaptive radiation
• (2) Natural selection
• (3) Convergent evolution
• (4) Divergent evolution

Following are the stages of the pathway for conduction of an action potential through the heart:

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of the pathway from the options given below:

• (1) E-C-A-D-B
• (2) A-E-C-B-D
• (3) B-D-E-C-A
• (4) E-A-D-B-C

Which of the following statements is incorrect?

• (1) A bio-reactor provides optimal growth conditions for achieving the desired product
  (2) Most commonly used bio-reactors are of stirring type
  (3) Bio-reactors are used to produce small scale bacterial cultures
  (4) Bio-reactors have an agitator system, an oxygen delivery system, and foam control system

Which of the following is not a component of the Fallopian tube?

• (1) Uterine fundus
• (2) Isthmus
• (3) Infundibulum
• (4) Ampulla

Given below are two statements:

Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the option given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

• (1) Genetic recombination
• (2) Genetic drift
• (3) Gene migration
• (4) Constant gene pool

Which of the following is not a steroid hormone?

• (1) Cortisol
• (2) Testosterone
• (3) Progesterone
• (4) Glucagon

Match List I with List II




Choose the correct answer from the options given below:

• (1) A-III, B-I, C-II, D-IV
• (2) A-I, B-III, C-IV, D-II
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-I, C-IV, D-II

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

• (1) 5th segment
• (2) 10th segment
• (3) 8th and 9th segment
• (4) 11th segment

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-III, B-II, C-IV, D-I
• (3) A-II, B-I, C-IV, D-III
• (4) A-I, B-III, C-II, D-IV

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-II, B-III, C-I, D-IV
• (2) A-III, B-IV, C-II, D-I
• (3) A-I, B-II, C-III, D-IV
• (4) A-II, B-I, C-IV, D-III

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false

The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:

• (1) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.
• (2) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
• (3) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
• (4) Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3’ TACATGGCAAATATCCATTCA 5’

• (1) 5’ AUGUACCGUUUAUAGGUAAGU 3’
• (2) 5’ AUGUAAAGUUUAUAGGUAAGU 3’
• (3) 5’ AUGUACCGUUUAUAGGGAAGU 3’
• (4) 5’ ATGTACCGTTTATAGGTAAGT 3’

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

• (1) A, B \& D only
• (2) A, B \& E only
• (3) B, C \& E only
• (4) C, D \& E only

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-II, C-I, D-IV

Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R):

Assertion (A): FSH acts upon ovarian follicles in females and Leydig cells in males.

Reason (R): Growing ovarian follicles secrete estrogen in females while interstitial cells secrete androgen in males.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A
• (2) Both A and R are true but R is NOT the correct explanation of A
• (3) A is true but R is false
• (4) A is false but R is true

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-III, B-II, C-I, D-IV
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-I, C-III, D-II

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-IV, B-II, C-III, D-I
• (3) A-II, B-IV, C-I, D-III
• (4) A-II, B-I, C-IV, D-III

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-II, C-IV, D-III
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-III, C-II, D-I

Consider the following statements:

A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates

Choose the correct answer from the options given below:

• (1) B only
• (2) A only
• (3) C only
• (4) D only

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-III, B-I, C-II, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-IV, C-I, D-III

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-III, C-I, D-IV
• (4) A-III, B-I, C-IV, D-II

Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:





Name of muscle/location

• (1) (a) Smooth - Toes, (b) Skeletal – Legs, (c) Cardiac – Heart
• (2) (a) Skeletal - Triceps, (b) Smooth – Stomach, (c) Cardiac – Heart
• (3) (a) Skeletal - Biceps, (b) Involuntary – Intestine, (c) Smooth – Heart
• (4) (a) Involuntary – Nose tip, (b) Skeletal – Bone, (c) Cardiac – Heart

Match List I with List II:

• (1) A-I, B-II, C-III, D-IV
• (2) A-II, B-III, C-IV, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-I, C-II, D-III

Which of the following factors are favorable for the formation of oxyhaemoglobin in alveoli?

• (1) High pO2 and High pCO2
• (2) High pO2 and Lesser H+ concentration
• (3) Low pCO2 and High H+ concentration
• (4) Low pCO2 and High temperature

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)

A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus

Choose the correct sequence of human evolution from the options given below:

• (1) D-A-C-B
• (2) B-A-D-C
• (3) C-B-D-A
• (4) A-D-C-B

Match List I with List II:





Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-I, D-II
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-I, C-III, D-IV
• (4) A-III, B-IV, C-I, D-II

Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R):
Assertion (A): Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason (R): Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both A and R are correct and R is the correct explanation of A
• (2) Both A and R are correct but R is NOT the correct explanation of A
• (3) A is correct but R is not correct
• (4) A is not correct but R is correct

Which of the following is not a natural/traditional contraceptive method?

• (1) Coitus interruptus
• (2) Periodic abstinence
• (3) Lactational amenorrhea
• (4) Vaults

The “Ti plasmid” of Agrobacterium tumefaciens stands for

• (1) Tumour inhibiting plasmid
• (2) Tumor independent plasmid
• (3) Tumor inducing plasmid
• (4) Temperature independent plasmid

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-IV, B-II, C-I, D-III
• (3) A-III, B-IV, C-II, D-I
• (4) A-III, B-IV, C-I, D-II

Given below are two statements:
Statement I: Mitochondria and chloroplasts both are double-membrane-bound organelles.
Statement II: The inner membrane of mitochondria is relatively less permeable, as compared to chloroplasts.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Regarding the catalytic cycle of an enzyme action, select the correct sequential steps:
A. Substrate-enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to the active site.

Choose the correct answer from the options given below:

• (1) E, A, D, C, B
• (2) A, E, B, D, C
• (3) B, A, C, D, E
• (4) E, D, C, B, A

Match List I with List II related to the digestive system of a cockroach:




Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-II, C-III, D-IV
• (3) A-IV, B-III, C-II, D-I
• (4) A-III, B-II, C-IV, D-I

The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post-anal tail is absent.

Choose the most appropriate answer from the options given below:

• (1) A \& C only
• (2) A, B \& D only
• (3) B, D \& E only
• (4) B, C \& D only

Choose the correct statement given below regarding juxtamedullary nephron.

• (1) Juxtamedullary nephrons are located in the columns of Bertini.
• (2) Renal corpuscle of juxtamedullary nephron lies in the outer portion of the renal medulla.
• (3) Loop of Henle of juxtamedullary nephron runs deep into medulla.
• (4) Juxtamedullary nephrons outnumber the cortical nephrons.

Given below are two statements:
Statement I: The cerebral hemispheres are connected by a nerve tract known as the corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons, and cerebrum.

In light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-I, B-III, C-IV, D-II
• (2) A-III, B-II, C-IV, D-I
• (3) A-II, B-III, C-I, D-IV
• (4) A-IV, B-II, C-I, D-III

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-I, B-II, C-IV, D-III
• (4) A-III, B-I, C-IV, D-II

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be


A. \( I^{B}I^{A} / ii \)

B. \( I^{B}I^{B} / I^{A}I^{A} \)

C. \( I^{A}I^{B} / ii \)

D. \( I^{A}I^{B} / I^{A}I^{i} \)

E. \( ii / I^{A}I^{B} / I^{A}I^{B} \)

• (1) A only
• (2) B only
• (3) C \& B only
• (4) D \& E only

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

Given below are two statements:

Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-IV, B-III, C-I, D-II
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-I, C-IV, D-III

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-III, B-II, C-IV, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-I, D-II

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

• (1) FSH, Leydig cells, Sertoli cells, spermiogenesis.
• (2) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
• (3) FSH, Sertoli cells, Leydig cells, spermatogenesis.
• (4) ICSH, Leydig cells, Sertoli cells, spermatogenesis.