NEET 2024 Question Paper with Answers and Solutions PDF Q5 in English

In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds. The moment of inertia of the needle is \(9.8 \times 10^{-6} \, kg m^2\). If the magnitude of the magnetic moment of the needle is \(x \times 10^{-5} \, Am^2\), then the value of 'x' is:




 

• (1) \(5\pi^2\)
• (2) \(128\pi^2\)
• (3) \(50\pi^2\)
• (4) \(1280\pi^2\)

A logic circuit provides the output Y as per the following truth table: 
The expression for the output Y is:

• (1) \( AB + \overline{A} \)
• (2) \( AB + A \)
• (3) \( \overline{B} \)
• (4) \( B \)

Consider the following statements A and B and identify the correct answer:





A. \text{For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.


B. In a reverse biased pn junction diode, the current measured in (\textmu A), is due to majority charge carriers.

• (1) A is correct but B is incorrect
• (2) A is incorrect but B is correct
• (3) Both A and B are correct
• (4) Both A and B are incorrect

A thin flat circular disc of radius \(4.5\) cm is placed gently over the surface of water. If surface tension of water is \(0.07 \, N m^{-1}\), then the excess force required to take it away from the surface is:

• (1) \( 19.8 mN \)
• (2) \( 198 N \)
• (3) \( 1.98 mN \)
• (4) \( 99 N \)

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \( v \) in the direction shown, which one of the following options is correct ( \( P \) and \( Q \) are any highest and lowest points on the wheel, respectively)?

• (1) Point P moves slower than point Q
• (2) Point \( P \) moves faster than point \( Q \)
• (3) Both the points \( P \) and \( Q \) move with equal speed
• (4) Point \( P \) has zero speed

In a vernier callipers, \( (N + 1) \) divisions of vernier scale coincide with \( N \) divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:

• (1) \( \frac{1}{10N} \)
• (2) \( \frac{1}{100(N+1)} \)
• (3) \( 100N \)
• (4) \( 10(N+1) \)

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

• (1) \( AB \) and \( DC \)
• (2) \( BA \) and \( CD \)
• (3) \( AB \) and \( CD \)
• (4) \( BA \) and \( DC \)

In the following circuit, the equivalent capacitance between terminal A and terminal B is:

• (1) \(2 )
  (2) \(1 )
  (3) \(0.5 )
  (4) \(4 )

The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus are \(8 \times 10^8 \, N m^{-2}\) and \(2 \times 10^{11} \, N m^{-2}\), respectively, is:

• (1) \(4 \, mm\)
• (2) \(0.4 \, mm\)
• (3) \(40 \, mm\)
• (4) \(8 \, mm\)

A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown in the figure is:






(Take \(\frac{1}{4\pi\epsilon_{0}}=9\times10^{9}\) SI units)

• (1) \(3\times10^{5}\)
  (2) \(1\times10^{5}\)
  (3) \(0.5\times10^{5}\)
  (4) Zero

The graph which shows the variation of \(\frac{1}{\lambda^{2}}\) and its kinetic energy E is (where \(\lambda\) is de Broglie wavelength of a free particle):

• (1)
  (2)
  (3)
  (4)

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole moment vector \(\vec{P}\) of magnitude, \(4 \times 10^{-6}\) C m, is \(\pm 9 \times 10^{3}\) V.

(Take \(\frac{1}{4\pi\epsilon_{0}} = 9 \times 10^{9}\) SI units)

Reason R: \(V = \pm \frac{2P}{4\pi\epsilon_{0}r^{2}}\), where r is the distance of any axial point, situated at 2 m from the centre of the dipole.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A.
  (2) Both A and R are true and R is NOT the correct explanation of A.
  (3) A is true but R is false.
  (4) A is false but R is true.

An unpolarised light beam strikes a glass surface at Brewster's angle. Then:

• (1) The reflected light will be partially polarised.
• (2) The refracted light will be completely polarised.
• (3) Both the reflected and refracted light will be completely polarised.
• (4) The reflected light will be completely polarised but the refracted light will be partially polarised.

Given below are two statements:

Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.

Statement II: Atoms of each element are stable and emit their characteristic spectrum.

In the light of the above statements, choose the most appropriate answer from the options given below.

• (1) Both Statement I and Statement II are correct
• (2) Both Statement I and Statement II are incorrect
• (3) Statement I is correct but Statement II is incorrect
• (4) Statement I is incorrect but Statement II is correct

A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:

• (1) Zero
• (2) 30 J
• (3) -90 J
• (4) -60 J

A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as \( 4\pi \times 10^{-7} \) SI units):

• (1) 44 mT
• (2) 4.4 T
• (3) 4.4 mT
• (4) 44 T

Match List I with List II.


List I (Spectral Lines of Hydrogen for transitions from) & List II (Wavelengths (nm))


A. \(n_2 = 3 \, to \, n_1 = 2\) & I. 410.2

B. \(n_2 = 4 \, to \, n_1 = 2\) & II. 434.1

C. \(n_2 = 5 \, to \, n_1 = 2\) & III. 656.3

D. \(n_2 = 6 \, to \, n_1 = 2\) & IV. 486.1



Choose the correct answer from the options given below:

• (1) A-I, B-II, C-III, D-IV
• (2) A-III, B-IV, C-II, D-I
• (3) A-IV, B-III, C-I, D-II
• (4) A-I, B-II, C-III, D-IV

Match List-I with List-II.


List-I (Material) & List-II (Susceptibility (\(\chi\)))


A. Diamagnetic & I. \(\chi = 0\)

B. Ferromagnetic & II. \(0 > \chi \geq -1\)

C. Paramagnetic & III. \(\chi \gg 1\)

D. Non-magnetic & IV. \(0 < \chi < \epsilon\) (a small positive number)

 

• (1) A-II, B-III, C-IV, D-I
• (2) A-I, B-II, C-III, D-IV
• (3) A-III, B-II, C-I, D-IV
• (4) A-IV, B-III, C-II, D-I

A light ray enters through a right angled prism at point P with the angle of incidence 30° as shown in the figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the prism is:

• (1) \( \frac{\sqrt{5}}{4} \)
• (2) \( \frac{\sqrt{5}}{2} \)
• (3) \( \frac{\sqrt{3}}{4} \)
• (4) \( \frac{\sqrt{3}}{2} \)

A bob is whirled in a horizontal plane by means of a string with an initial speed of \( \omega \) rpm. The tension in the string is \( T \). If speed becomes \( 2\omega \) while keeping the same radius, the tension in the string becomes:

• (1) \( T \)
• (2) \( 4T \)
• (3) \( \frac{T}{4} \)
• (4) \( \sqrt{2}T \)

A wire of length \( f \) and resistance 100 \( \Omega \) is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

• (1) 26 \( \Omega \)
• (2) 52 \( \Omega \)
• (3) 55 \( \Omega \)
• (4) 60 \( \Omega \)

If \( c \) is the velocity of light in free space, the correct statements about photon among the following are:

A. The energy of a photon is \( E = h\nu \).

B. The velocity of a photon is \( c \).

C. The momentum of a photon, \( p = \frac{h\nu}{c} \).

D. In a photon-electron collision, both total energy and total momentum are conserved.

E. Photon possesses positive charge.

Choose the correct answer from the options given below:

• (1) A and B only
• (2) A, B, C and D only
• (3) A, C and D only
• (4) A, B and E only

At any instant of time \( t \), the displacement of any particle is given by \( 2t - 1 \) (SI unit) under the influence of force of 5 N. The value of instantaneous power is (in SI unit):

• (1) 10
• (2) 5
• (3) 7
• (4) 6

A particle moving with uniform speed in a circular path maintains:

• (1) Constant velocity
• (2) Constant acceleration
• (3) Constant velocity but varying acceleration
• (4) Varying velocity and varying acceleration

If the monochromatic source in Young's double slit experiment is replaced by white light, then:

• (1) Interference pattern will disappear
• (2) There will be a central dark fringe surrounded by a few coloured fringes
• (3) There will be a central bright white fringe surrounded by a few coloured fringes
• (4) All bright fringes will be of equal width

The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 \( \Omega \), when connected through an external resistance of 4 \( \Omega \) as shown in the figure is:

• (1) 4 V
• (2) 6 V
• (3) 8 V
• (4) 10 V

If \( x = 5 \sin\left( \pi t + \frac{\pi}{3} \right) \, m \) represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are:

• (1) 5 cm, 2 s
• (2) 5 m, 2 s
• (3) 5 cm, 1 s
• (4) 5 m, 1 s

The moment of inertia of a thin rod about an axis passing through its midpoint and perpendicular to the rod is 2400 g cm\(^2\). The length of the 400 g rod is nearly:

• (1) 8.5 cm
• (2) 17.5 cm
• (3) 20.7 cm
• (4) 72.0 cm

In an ideal transformer, the turns ratio is \( \frac{N_P}{N_S} = \frac{1}{2} \). The ratio \( V_S : V_P \) is equal to (the symbols carry their usual meaning):

• (1) 1 : 2
• (2) 2 : 1
• (3) 1 : 1
• (4) 1 : 4

A horizontal force 10 N is applied to a block A as shown in the figure. The mass of blocks A and B are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is:

• (1) Zero
• (2) 4 N
• (3) 6 N
• (4) 10 N

The output (Y) of the given logic gate is similar to the output of an/a:

• (1) NAND gate
• (2) NOR gate
• (3) OR gate
• (4) AND gate

The quantities which have the same dimensions as those of solid angle are:

• (1) Strain and angle
• (2) Stress and angle
• (3) Strain and arc
• (4) Angular speed and stress

In the nuclear emission stated above, the mass number and atomic number of the product Q, respectively, are:
\[ \prescript{290}{82}X \xrightarrow{\alpha} Y \xrightarrow{e^+} Z \xrightarrow{\beta^-} P \xrightarrow{e^-} Q \]

• (1) 280, 81
  (2) 286, 80
  (3) 288, 82
  (4) 286, 81

The mass of a planet is \( \frac{1}{10} \)th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:

• (1) \(19.6 \, \mathrm{m \, s^{-2}}\)
• (2) \(9.8 \, \mathrm{m \, s^{-2}}\)
• (3) \(4.9 \, \mathrm{m \, s^{-2}}\)
• (4) \(3.92 \, \mathrm{m \, s^{-2}}\)

Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity \( v_1 \) while body B is at rest before collision. The velocity of the system after collision is \( v_2 \). The ratio \( v_1 : v_2 \) is:

• (1) 1 : 2
• (2) 2 : 1
• (3) 1 : 1
• (4) 1 : 4

Choose the correct circuit which can achieve the bridge balance.

The velocity (\( v \)) – time (\( t \)) plot of the motion of a body is shown below:





The acceleration (\( a \)) – time (\( t \)) graph that best suits this motion is:

A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of the telescope for viewing a distant object is:

• (1) 34
  (2) 28
  (3) 17
  (4) 32

The minimum energy required to launch a satellite of mass \( m \) from the surface of earth of mass \( M \) and radius \( R \) in a circular orbit at an altitude of \( 2R \) from the surface of the earth is:

• (1) \( \frac{5GMm}{6R} \)
  (2) \( \frac{2GMm}{3R} \)
  (3) \( \frac{GMm}{2R} \)
  (4) \( \frac{GMm}{3R} \)

A 10 \( \mu F \) capacitor is connected to a 210 V, 50 Hz source as shown in the figure. The peak current in the circuit is nearly ( \( \pi = 3.14 \)):

• (1) 0.58 A
  (2) 0.93 A
  (3) 1.20 A
  (4) 0.35 A

A metallic bar of Young's modulus, \( 0.5 \times 10^{11} \, N/m^2 \) and coefficient of linear thermal expansion \( 10^{-5} \, °C^{-1} \), length 1 m and area of cross-section \( 10^{-3} \, m^2 \) is heated from 0°C to 100°C without expansion or bending. The compressive force developed in it is:

• (1) \( 5 \times 10^3 \, N \)
• (2) \( 50 \times 10^3 \, N \)
• (3) \( 100 \times 10^3 \, N \)
• (4) \( 2 \times 10^3 \, N \)

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:

A. hold the sheet there if it is magnetic.

B. hold the sheet there if it is non-magnetic.

C. move the sheet away from the pole with uniform velocity if it is conducting.

D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.

• (1) B and D only
• (2) A and C only
• (3) A, C and D only
• (4) C only

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then:

A. the charge stored in it, increases.

B. the energy stored in it, decreases.

C. its capacitance increases.

D. the ratio of charge to its potential remains the same.

E. the product of charge and voltage increases.

• (1) A, B and E only
• (2) A, C and E only
• (3) B, D and E only
• (4) A, B and C only

Two heaters A and B have power ratings of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

• (1) 1 : 1
• (2) 2 : 9
• (3) 1 : 2
• (4) 2 : 3

If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is \( \frac{x}{2} \) times its original time period. Then the value of \( x \) is:

• (1) \( \sqrt{3} \)
• (2) \( \sqrt{2} \)
• (3) \( 2\sqrt{3} \)
• (4) 4

An iron bar of length \( L \) has magnetic moment \( M \). It is bent at the middle of its length such that the two arms make an angle 60° with each other. The magnetic moment of this new magnet is:

• (1) \( M \)
• (2) \( \frac{M}{2} \)
• (3) \( 2M \)
• (4) \( \frac{M}{\sqrt{3}} \)

The property which is not of an electromagnetic wave travelling in free space is that:

• (1) They are transverse in nature
• (2) The energy density in electric field is equal to energy density in magnetic field
• (3) They travel with a speed equal to \( \frac{1}{\sqrt{\mu_0 \epsilon_0}} \)
• (4) They originate from charges moving with uniform speed

A force defined by \( F = \alpha t^2 + \beta t \) acts on a particle at a given time \( t \). The factor which is dimensionless, if \( \alpha \) and \( \beta \) are constants, is:

• (1) \( \frac{\beta t}{\alpha} \)
• (2) \( \frac{a t}{\beta} \)
• (3) \( \alpha \beta t \)
• (4) \( \frac{\alpha \beta}{t} \)

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If \( I \) is the current in the circuit, then in the gap between the plates:

• (1) There is no current
• (2) Displacement current of magnitude equal to \( I \) flows in the same direction as \( I \)
• (3) Displacement current of magnitude equal to \( I \) flows in a direction opposite to that of \( I \)
• (4) Displacement current of magnitude greater than \( I \) flows but can be in any direction

The following graph represents the T-V curves of an ideal gas (where \( T \) is the temperature and \( V \) the volume) at three pressures \( P_1, P_2 \) and \( P_3 \) compared with those of Charles's law represented as dotted lines.

• (1) \( P_3 > P_2 > P_1 \)
• (2) \( P_1 > P_3 > P_2 \)
• (3) \( P_2 > P_1 > P_3 \)
• (4) \( P_1 > P_2 > P_3 \)

Fehling's solution ‘A’ is:

• (1) aqueous copper sulphate
• (2) alkaline copper sulphate
• (3) alkaline solution of sodium potassium tartrate (Rochelle's salt)
• (4) aqueous sodium citrate

Match List I with List II.

\begin{table[h!]
\centering
\begin{tabular{|c|c|
\hline
List I (Molecule) & List II (Number and types of bonds between two carbon atoms)

\hline
A. ethane & I. one \(\sigma\)-bond and two \(\pi\)-bonds

B. ethene & II. two \(\pi\)-bonds

C. carbon molecule, C\(_2\) & III. one \(\sigma\)-bond

D. ethyne & IV. one \(\sigma\)-bond and one \(\pi\)-bond

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

• (1) A-I, B-IV, C-II, D-III
• (2) A-IV, B-III, C-I, D-II
• (3) A-III, B-IV, C-II, D-I
• (4) A-III, B-IV, C-I, D-II

Identify the correct reagents that would bring about the following transformation.

• (1) (i) H\(_2\)O / H\(^+\)
  (ii) CrO\(_3\)
  (2) (i) BH\(_3\)
  (ii) H\(_2\)O\(_2\) / OH
  (iii) PCC
  (3) (i) BH\(_3\)
  (ii) H\(_2\)O\(_2\) / OH
  (iii) alk.KMnO\(_4\)
  (iv) H\(_3\)O\(^+\)
  (4) (i) H\(_2\)O / H\(^+\)
  (ii) PCC

For the reaction \( 2A \rightleftharpoons B + C \), \( K_C = 4 \times 10^{-3} \). At a given time, the composition of reaction mixture is [A] = [B] = [C] = \( 2 \times 10^{-3} \, M \). Then, which of the following is correct?

• (1) Reaction is at equilibrium.
• (2) Reaction has a tendency to go in forward direction.
• (3) Reaction has a tendency to go in backward direction.
• (4) Reaction has gone to completion in forward direction.

Match List I with List II.

\begin{table[h!]
\centering
\begin{tabular{|c|c|
\hline
List I (Process) & List II (Conditions)

\hline
A. Isothermal process & I. No heat exchange

B. Isochoric process & II. Carried out at constant temperature

C. Isobaric process & III. Carried out at constant volume

D. Adiabatic process & IV. Carried out at constant pressure

\hline
\end{tabular
\end{table
Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-IV, B-II, C-III, D-I
• (3) A-I, B-III, C-II, D-IV
• (4) A-II, B-III, C-IV, D-I

Match List I with List II.


\begin{table[h!]
\centering
\begin{tabular{|c|c|
\hline
List I (Complex) & List II (Type of isomerism)

\hline
A. [Co(NH\(_3\))\(_5\)(NO\(_2\))]Cl\(_2\) & I. Solvate isomerism

B. [Co(NH\(_3\))\(_5\)(SO\(_4\))]Br & II. Linkage isomerism

C. [Co(NH\(_3\))\(_6\)][Cr(CN)\(_6\)] & III. Ionization isomerism

D. [Co(H\(_2\)O)\(_6\)]Cl\(_3\) & IV. Coordination isomerism

\hline
\end{tabular
\caption{Matching Complexes with Their Types of Isomerism
\end{table

• (1) A-I, B-III, C-IV, D-I
• (2) A-II, B-III, C-IV, D-I
• (3) A-I, B-IV, C-II, D-II
• (4) A-II, B-IV, C-I, D-II

Given below are two statements:

Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.

Statement II: Aniline cannot be prepared through Gabriel synthesis.

• (1) Both statement I and statement II are true
• (2) Both statement I and statement II are false
• (3) Statement I is correct but statement II is false
• (4) Statement I is incorrect but statement II is true

‘Spin only’ magnetic moment is same for which of the following ions?

A. Ti\(^{3+}\)

B. Cr\(^{2+}\)

C. Mn\(^{2+}\)

D. Fe\(^{2+}\)

E. Sc\(^{3+}\)

• (1) B and D only
• (2) A and E only
• (3) B and C only
• (4) A and D only

Arrange the following elements in increasing order of first ionization enthalpy.

Li, Be, B, C, N

• (1) Li \(<\) Be \(<\) B \(<\) C \(<\) N
• (2) Li \(<\) B \(<\) Be \(<\) C \(<\) N
• (3) Li \(<\) B \(<\) Be \(<\) C \(<\) N
• (4) Li \(<\) Be \(<\) C \(<\) B \(<\) N

Match List I with List II.

\begin{table[h!]
\centering
\begin{tabular{|l|l|
\hline
List I (Quantum Number) & List II (Information provided)

\hline
A. \( m_l \) & I. Shape of orbital

B. \( m_s \) & II. Size of orbital

C. \( l \) & III. Orientation of orbital

D. \( n \) & IV. Orientation of spin of electron

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below :

• (1) A-I, B-III, C-II, D-IV
• (2) A-III, B-IV, C-I, D-II
• (3) A-III, B-IV, C-II, D-I
• (4) A-II, B-I, C-IV, D-III

1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to:

• (1) 750 mg
• (2) 250 mg
• (3) Zero
• (4) 200 mg

Match List I with List II.


\begin{table[h!]
\centering
\begin{tabular{|c|c|
\hline
List I (Conversion) & List II (Number of Faraday required)

\hline
A. 1 mol of H\(_2\)O to O\(_2\) & I. 3F

B. 1 mol of MnO\(_4^-\) to Mn\(^{2+}\) & II. 2F

C. 1.5 mol of Ca from molten CaCl\(_2\) & III. 1F

D. 1 mol of FeO to Fe\(_2\)O\(_3\) & IV. 5F

\hline
\end{tabular
\end{table
Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-III, B-IV, C-I, D-II
• (3) A-II, B-III, C-II, D-IV
• (4) A-III, B-IV, C-II, D-I

Which one of the following alcohols reacts instantaneously with Lucas reagent?

Correct Answer: (4)
View Solution

Which plot of ln k vs \( \frac{1}{T} \) is consistent with Arrhenius equation?

Correct Answer: (4)
View Solution

The Henry's law constant (K\(_H\)) values of three gases (A, B, C) in water are 145, \( 2 \times 10^{-5} \) and 35 kbar, respectively. The solubility of these gases in water follows the order:

• (1) B \(>\) A \(>\) C
• (2) B \(>\) C \(>\) A
• (3) A \(>\) C \(>\) B
• (4) A \(>\) B \(>\) C

On heating, some solid substances change from solid to vapor state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as:

• (1) Crystallization
• (2) Sublimation
• (3) Distillation
• (4) Chromatography

Given below are two statements:

Statement I: Both \([ Co(NH_3)_6]^{3+}\) and \([ CoF_6]^{3-}\) complexes are octahedral but differ in their magnetic behaviour.

Statement II: \([ Co(NH_3)_6]^{3+}\) is diamagnetic whereas \([ CoF_6]^{3-}\) is paramagnetic.

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

The E° value for the Mn\(^{3+}\)/Mn\(^{2+}\) couple is more positive than that of Cr\(^{3+}\)/Cr\(^{2+}\) or Fe\(^{3+}\)/Fe\(^{2+}\) due to change of

• (1) \(d^5\) to \(d^4\) configuration
• (2) \(d^5\) to \(d^2\) configuration
• (3) \(d^4\) to \(d^5\) configuration
• (4) \(d^3\) to \(d^5\) configuration

The compound that will undergo SN1 reaction with the fastest rate is:

Correct Answer: (4)
View Solution

Activation energy of any chemical reaction can be calculated if one knows the value of:

• (1) rate constant at standard temperature
• (2) probability of collision
• (3) orientation of reactant molecules during collision
• (4) rate constant at two different temperatures

Given below are two statements:

Statement I: The boiling point of three isomeric pentanes follows the order n-pentane \(>\) isopentane \(>\) neopentane.

Statement II: When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct
• (2) Both Statement I and Statement II are incorrect
• (3) Statement I is correct but Statement II is incorrect
• (4) Statement I is incorrect but Statement II is correct

A compound with a molecular formula of C\(_6\)H\(_{14}\) has two tertiary carbons. Its IUPAC name is:

• (1) n-hexane
• (2) 2-methylpentane
• (3) 2,3-dimethylbutane
• (4) 2,2-dimethylbutane

The energy of an electron in the ground state (n = 1) for He\(^+\) ion is -x J, then that for an electron in n = 2 state for Be\(^{3+}\) ion in J is:

• (1) -x
• (2) \( \frac{x}{9} \)
• (3) -4x
• (4) \( \frac{-4x}{9} \)

Match List I with List II.

Which reaction is NOT a redox reaction?

• (1) Zn + CuSO\(_4\) \(\rightarrow\) ZnSO\(_4\) + Cu
• (2) 2KClO\(_3\) \(\rightarrow\) 2KClO\(_3\) + Cl\(_2\)
• (3) H\(_2\) + Cl\(_2\) \(\rightarrow\) 2HCl
• (4) BaCl\(_2\) + Na\(_2\)SO\(_4\) \(\rightarrow\) BaSO\(_4\) + 2NaCl

Match List I with List II.

• (1) A-I, B-IV, C-II, D-III
• (2) A-II, B-IV, C-III, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-III, C-IV, D-I

Given below are two statements:

Statement I: The boiling point of hydrides of Group 16 elements follow the order \( H_2O > H_2Te > H_2Se > H_2S \).

Statement II: On the basis of molecular mass, \( H_2O \) is expected to have a lower boiling point than the other members of the group but due to the presence of extensive H-bonding in \( H_2O \), it has a higher boiling point.


In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

The highest number of helium atoms is in:

• (1) 4 mol of helium
• (2) 4 u of helium
• (3) 3 g of helium
• (4) 2.271098 L of helium at STP

Intramolecular hydrogen bonding is present in:

The reagents with which glucose does not react to give the corresponding tests/products are:


A. Tollen's reagent
B. Schiff's reagent
C. HCN
D. NH\(_2\)OH
E. NaHSO\(_3\)

• (1) B and C
• (2) A and D
• (3) B and E
• (4) E and D

In which of the following processes entropy increases?


A. A liquid evaporates to vapour.
B. Temperature of a crystalline solid lowered from 130 K to 0 K.
C. \( 2NaHCO_3(s) \rightarrow Na_2CO_3(s) + CO_2(g) + H_2O(g) \)
D. \( Cl_2(g) \rightarrow 2Cl(g) \)


Choose the correct answer from the options given below:

• (1) A and C
• (2) A, B and D
• (3) A, C and D
• (4) C and D

Among Group 16 elements, which one does NOT show -2 oxidation state?

• (1) O
• (2) Se
• (3) Te
• (4) Po

Arrange the following elements in increasing order of electronegativity:

N, O, F, C, Si

Choose the correct answer from the options given below:

• (1) Si \(<\) C \(<\) N \(<\) O \(<\) F
• (2) Si \(<\) C \(<\) O \(<\) N \(<\) F
• (3) O \(<\) F \(<\) N \(<\) C \(<\) Si
• (4) F \(<\) O \(<\) N \(<\) C \(<\) Si

The most stable carbocation among the following is:

Correct Answer: (4)
View Solution

In which of the following equilibria, Kp and Kc are NOT equal?

The pair of lanthanoid ions which are diamagnetic is:

• (1) Ce\(^{4+}\) and Yb\(^{2+}\)
• (2) Ce\(^{3+}\) and Eu\(^{2+}\)
• (3) Gd\(^{3+}\) and Eu\(^{3+}\)
• (4) Pm\(^{3+}\) and Sm\(^{3+}\)

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is:

(Given R = 2.0 cal K\(^{-1}\) mol\(^{-1}\))

• (1) 0 calorie
• (2) -413.14 calories
• (3) 413.14 calories
• (4) 100 calories

The products A and B obtained in the following reactions, respectively, are:
\[ 3ROH + PCl_3 \rightarrow 3RCl + A
ROH + PCl_5 \rightarrow RCl + HCl + B \]

Major products A and B formed in the following reaction sequence, are:

Correct Answer: (1)
View Solution

Identify the major product C formed in the following reaction sequence:
\[ CH_3CH_2CH_2OH \xrightarrow{NaCN} A \quad \xrightarrow{OH^-} B \quad \xrightarrow{NaOH, Br_2} C \]

• (1) propylamine
• (2) butylamine
• (3) butanamide
• (4) \(\alpha\)-bromobutanoic acid

A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is: \[ (Given atomic masses of A = 64; B = 40; C = 32 u) \]

• (1) \(A_2BC_2\)
• (2) \(ABC_3\)
• (3) \(A_2B_2C_2\)
• (4) \(ABC_4\)

The rate of a reaction quadruples when temperature changes from 27\(^\circ\)C to 57\(^\circ\)C. Calculate the energy of activation.
\[ Given: R = 8.314 \, J K^{-1} \, mol^{-1}, \log 4 = 0.6021 \]

• (1) 38.04 kJ/mol
• (2) 380.4 kJ/mol
• (3) 3.80 kJ/mol
• (4) 3804 kJ/mol

During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of \(Fe^{2+}\) ion?

• (1) dilute hydrochloric acid
• (2) concentrated sulphuric acid
• (3) dilute nitric acid
• (4) dilute sulphuric acid

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given: Molar mass of Cu = 63 g/mol, 1 F = 96487 C)

• (1) 3.15 g
• (2) 0.315 g
• (3) 31.5 g
• (4) 0.0315 g

Given below are two statements:

• (1) Both Statement I and Statement II are true
  (2) Both Statement I and Statement II are false
  (3) Statement I is true but Statement II is false
  (4) Statement I is false but Statement II is true

Identify the correct answer.

• (1) Three resonance structures can be drawn for ozone
• (2) \(BF_3\) has non-zero dipole moment.
• (3) Dipole moment of \(NF_3\) is greater than that of \(NH_3\).
• (4) Three canonical forms can be drawn for \(CO_3^{2-}\) ion.

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.

A. Al\(^{3+}\)

B. Cu\(^{2+}\)

C. Ba\(^{2+}\)

D. Co\(^{2+}\)

E. Mg\(^{2+}\)

Choose the correct answer from the options given below:

• (1) E, C, D, B, A
• (2) E, A, B, C, D
• (3) B, A, D, C, E
• (4) B, C, A, D, E

For the given reaction:

Consider the following reaction in a sealed vessel at equilibrium with concentrations of
\(N_2 = 3.0 \times 10^{-3} \, M\), \(O_2 = 4.2 \times 10^{-3} \, M\), and \(NO = 2.8 \times 10^{-3} \, M\).

The reaction is: \(2NO(g) \rightleftharpoons N_2(g) + O_2(g)\)

If 0.1 mol L\(^{-1}\) of NO(g) is taken in a closed vessel, what will be the degree of dissociation (\(\alpha\)) of NO(g) at equilibrium?

• (1) 0.8889
• (2) 0.717
• (3) 0.00889
• (4) 0.0889

The plot of osmotic pressure (\(\Pi\)) vs concentration (mol L\(^{-1}\)) for a solution gives a straight line with slope 25.73 L bar mol\(^{-1}\). The temperature at which the osmotic pressure measurement is done is:

Use \( R = 8.314 \, L bar mol^{-1} K^{-1} \), \( \log 4 = 0.6021 \).

• (1) 37°C
• (2) 310°C
• (3) 25.73°C
• (4) 12.05°C

Which of the following are required for the dark reaction of photosynthesis?

A. Light

B. Chlorophyll

C. CO\(_2\)

D. ATP

E. NADPH


Choose the correct answer from the options given below:

• (1) A, B and C only
• (2) B, C and D only
• (3) C, D and E only
• (4) D and E only

Match List I with List II:





Choose the correct answer from the options given below:

• (1) A-I, B-II, C-III, D-IV
• (2) A-II, B-I, C-IV, D-III
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-II, D-I

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end:

% Choose the correct answer from the options given below:

• (1) Repressor, Operator gene, Structural gene
• (2) Structural gene, Transposons, Operator gene
• (3) Inducer, Repressor, Structural gene
• (4) Promotor, Structural gene, Terminator

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

• (1) Only red flowered plants
• (2) Red flowered as well as pink flowered plants
• (3) Only pink flowered plants
• (4) Red, Pink as well as white flowered plants

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

• (1) Cofactor inhibition
• (2) Feedback inhibition
• (3) Competitive inhibition
• (4) Enzyme activation

Spindle fibers attach to kinetochores of chromosomes during:

• (1) Prophase
• (2) Metaphase
• (3) Anaphase
• (4) Telophase

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List-I & \multicolumn{2{c|{List-II

\hline
A. & Nucleolus & I. & Site of formation of glycolipid

B. & Centriole & II. & Organization like the cartwheel

C. & Leucoplasts & III. & Site for active ribosomal RNA synthesis

D. & Golgi apparatus & IV. & For storing nutrients

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-II, C-I, D-IV
• (3) A-III, B-II, C-IV, D-I
• (4) A-I, B-III, C-II, D-IV

Tropical regions show greatest level of species richness because:

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.

B. Tropical environments are more seasonal.

C. More solar energy is available in tropics.

D. Constant environments promote niche specialization.

E. Tropical environments are constant and predictable.


Choose the correct answer from the options given below:

• (1) A, C, D and E only
• (2) A and B only
• (3) A, B and E only
• (4) A, B and D only

The equation of Verhulst-Pearl logistic growth is \(\frac{dN}{dt} = rN \left[\frac{K - N}{K}\right]\). From this equation, K indicates:

• (1) Intrinsic rate of natural increase
• (2) Biotic potential
• (3) Carrying capacity
• (4) Population density

Identify the set of correct statements:

A. The flowers of \textit{Vallisneria are colourful and produce nectar.

B. The flowers of water lily are not pollinated by water.

C. In most water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon like.

E. In some hydrophytes, the pollen grains are carried passively inside water.


Choose the correct answer from the options given below:

• (1) C, D and E only
• (2) A, B, C and D only
• (3) A, C, D and E only
• (4) B, C, D and E only

How many molecules of ATP and NADPH are required for every molecule of CO\(_2\) fixed in the Calvin cycle?


(1) 2 molecules of ATP and 3 molecules of NADPH

(2) 2 molecules of ATP and 2 molecules of NADPH

(3) 3 molecules of ATP and 3 molecules of NADPH

(4) 3 molecules of ATP and 2 molecules of NADPH

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called:

• (1) Semi-conservative method
• (2) Sustainable development
• (3) in-situ conservation
• (4) Biodiversity conservation

These are regarded as major causes of biodiversity loss:

A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration


Choose the correct option:

• (1) A, C and D only
• (2) A, B, C and D only
• (3) A, B and E only
• (4) A, B and D only

Formation of interfascicular cambium from fully developed parenchyma cells is an example for:

• (1) Differentiation
• (2) Redifferentiation
• (3) Dedifferentiation
• (4) Maturation

The capacity to generate a whole plant from any cell of the plant is called:

• (1) Totipotency
• (2) Micropropagation
• (3) Differentiation
• (4) Somatic hybridization

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

• (1) Beta-galactosidase
• (2) Acetylase
• (3) Permease
• (4) Polymerase

Hind III always cuts DNA molecules at a particular point called recognition sequence and it consists of:

• (1) 8 bp
• (2) 6 bp
• (3) 4 bp
• (4) 10 bp

Given below are two statements:

Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.

Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.


Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

List of endangered species was released by:

• (1) GEAC
• (2) WWF
• (3) FOAM
• (4) IUCN

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List-I & \multicolumn{2{c|{List-II

\hline
A. & Rhizopus & I. & Mushroom

B. & Ustilago & II. & Smut fungus

C. & Puccinia & III. & Bread mould

D. & Agaricus & IV. & Rust fungus

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-III, B-II, C-IV, D-I
• (2) A-II, B-III, C-I, D-IV
• (3) A-III, B-I, C-I, D-IV
• (4) A-IV, B-III, C-I, D-I

Given below are two statements:

Statement I: Bt toxins are insect group specific and coded by a gene \textit{cry IAc.

Statement II: Bt toxin exists as inactive protoxin in \textit{Bacillus thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut.


Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Given below are two statements:

Statement I: Parenchyma is living but collenchyma is dead tissue.

Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.


Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Which one of the following can be explained on the basis of Mendel's Law of Dominance?

A. Out of one pair of factors one is dominant and the other is recessive.

B. Alleles do not show any expression and both the characters appear as such in \( F_2 \) generation.

C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.

E. The expression of only one of the parental characters is found in a monohybrid cross.

Choose the correct option:

• (1) A, B and C only
• (2) A, C, D and E only
• (3) B, C and D only
• (4) A, B, C, D and E

Which of the following is an example of actinomorphic flower?

• (1) Datura
• (2) Cassia
• (3) Pisum
• (4) Sesbania

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

• (1) A
• (2) B
• (3) C
• (4) D

In a plant, black seed color (\(BB/Bb\)) is dominant over white seed color (\(bb\)). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

• (1) \(BB\)
• (2) \(bb\)
• (3) \(Bb\)
• (4) \(BB/Bb\)

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b):

• (1) (a) Epigynous; (b) Hypogynous
• (2) (a) Hypogynous; (b) Epigynous
• (3) (a) Perigynous; (b) Epigynous
• (4) (a) Perigynous; (b) Perigynous

The cofactor of the enzyme carboxypeptidase is:

• (1) Zinc
• (2) Niacin
• (3) Flavin
• (4) Haem

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin:

• (1) promotes apical dominance
• (2) promotes abscission of mature leaves only
• (3) does not affect mature monocotyledonous plants
• (4) can help in cell division in grasses, to produce growth

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Clostridium butylicum & I. & Ethanol

B. & Saccharomyces cerevisiae & II. & Streptokinase

C. & Trichoderma polysporum & III. & Butyric acid

D. & Streptococcus sp. & IV. & Cyclosporin-A

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-III, B-II, C-I, D-IV
• (2) A-II, B-IV, C-III, D-I
• (3) A-III, B-I, C-IV, D-II
• (4) A-IV, B-II, C-III, D-I

Bulliform cells are responsible for:

• (1) Inward curling of leaves in monocots.
• (2) Protecting the plant from salt stress.
• (3) Increased photosynthesis in monocots.
• (4) Providing large spaces for storage of sugars.

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

• (1) Amino acids
• (2) Phospholipids
• (3) Glycerides
• (4) Carbohydrates

What is the fate of a piece of DNA carrying only one gene of interest which is transferred into an alien organism?

• (1) A and B only
• (2) B and E only
• (3) B and C only
• (4) A and E only

Which one of the following is not a criterion for classification of fungi?

• (1) Morphology of mycelium
• (2) Mode of nutrition
• (3) Mode of spore formation
• (4) Fruiting body

In the given figure, which component has thin outer walls and highly thickened inner walls?

• (1) C
• (2) D
• (3) A
• (4) B

Identify the correct description about the given figure:

• (1) Wind pollinated plant inflorescence showing flowers with well exposed stamens.
• (2) Water pollinated flowers showing stamens with mucilaginous covering.
• (3) Cleistogamous flowers showing autogamy.
• (4) Compact inflorescence showing complete autogamy.

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus increasing the yield?

• (1) Auxin
• (2) Gibberellin
• (3) Cytokinin
• (4) Abscisic acid

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

• (1) Malic acid → Oxaloacetic acid
• (2) Succinic acid → Malic acid
• (3) Succinyl-CoA → Succinic acid
• (4) Isocitrate \( \rightarrow \) \(\alpha\)-ketoglutaric acid

Which of the following are fused in somatic hybridization involving two varieties of plants?

• (1) Callus
• (2) Somatic embryos
• (3) Protoplasts
• (4) Pollens

The DNA present in chloroplast is:

• (1) Linear, double stranded
• (2) Circular, double stranded
• (3) Linear, single stranded
• (4) Circular, single stranded

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Robert May & I. & Species-Area relationship

B. & Alexander von Humboldt & II. & Long term ecosystem experiment using outdoor plots

C. & Paul Ehrlich & III. & Global species diversity at about 7 million

D. & David Tilman & IV. & Rivet popper hypothesis

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-III, B-III, C-I, D-IV
• (2) A-III, B-I, C-IV, D-II
• (3) A-II, B-III, C-II, D-I
• (4) A-III, B-IV, C-II, D-I

Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

A. Asexual reproduction occurs usually by biflagellate zoospores.

B. Sexual reproduction is by oogamous method only.

C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.

D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.

E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.

Choose the correct answer from the options given below:

• (1) A, B, C and D only
• (2) B, C, D and E only
• (3) A, C, D and E only
• (4) A, B, C and E only

Given below are two statements:

Statement I: In C3 plants, some \(O_2\) binds to RuBisCO, hence \(CO_2\) fixation is decreased.

Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.


Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Which of the following statement is correct regarding the process of replication in E.coli?

• (1) The DNA dependent DNA polymerase catalyzes polymerization in one direction that is 3' → 5'
• (2) The DNA dependent RNA polymerase catalyzes polymerization in one direction, that is 5' → 3'
• (3) The DNA dependent DNA polymerase catalyzes polymerization in 5' → 3' as well as 3' → 5' direction
• (4) The DNA dependent DNA polymerase catalyzes polymerization in 5' → 3' direction

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Rose & I. & Twisted aestivation

B. & Pea & II. & Perigynous flower

C. & Cotton & III. & Drupe

D. & Mango & IV. & Marginal placentation

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-II, B-III, C-IV, D-I
• (3) A-II, B-IV, C-I, D-III
• (4) A-I, B-II, C-III, D-IV

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Citric acid cycle & I. & Cytoplasm

B. & Glycolysis & II. & Mitochondrial matrix

C. & Electron transport system & III. & Intermembrane space of mitochondria

D. & Proton gradient & IV. & Inner mitochondrial membrane

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-I, B-II, C-III, D-IV
• (2) A-II, B-I, C-IV, D-III
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-II, D-I

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I (Types of Stamens) & \multicolumn{2{c|{List II (Example)

\hline
A. & Monadelphous & I. & Citrus

B. & Diadelphous & II. & Pea

C. & Polyadelphous & III. & Lily

D. & Epiphyllous & IV. & China-rose

\hline
\end{tabular


% Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-I, D-III
• (2) A-IV, B-I, C-II, D-III
• (3) A-I, B-II, C-IV, D-III
• (4) A-III, B-I, C-IV, D-II

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Frederick Griffith & I. & Genetic code

B. & Francois Jacob \& Jacque Monod & II. & Semi-conservative mode of DNA replication

C. & Har Gobind Khorana & III. & Transformation

D. & Meselson \& Stahl & IV. & Lac operon

\hline
\end{tabular


Choose the correct answer from the options given below:

• (1) A-III, B-II, C-I, D-IV
• (2) A-III, B-IV, C-I, D-II
• (3) A-III, B-II, C-IV, D-I
• (4) A-IV, B-I, C-II, D-III

Match List-I with List-II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & GLUT-4 & I. & Hormone

B. & Insulin & II. & Enzyme

C. & Trypsin & III. & Intercellular ground substance

D. & Collagen & IV. & Enables glucose transport into cells

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-IV, B-I, C-II, D-III
• (2) A-I, B-II, C-III, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-IV, C-I, D-II

In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m\(^{-2}\) yr\(^{-1}\)), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

• (1) \( \frac{x}{10} \) (kcal m\(^{-2}\) yr\(^{-1}\))
• (2) \( x \) (kcal m\(^{-2}\) yr\(^{-1}\))
• (3) \( 10x \) (kcal m\(^{-2}\) yr\(^{-1}\))
• (4) \( \frac{100x}{3} \) (kcal m\(^{-2}\) yr\(^{-1}\))

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

Choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A
• (2) Both A and R are true but R is NOT the correct explanation of A
• (3) A is true but R is false
• (4) A is false but R is true

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Pons & I. & Provides additional space for Neurons, regulates posture and balance.

B. & Hypothalamus & II. & Controls respiration and gastric secretions.

C. & Medulla & III. & Connects different regions of the brain.

D. & Cerebellum & IV. & Neuro secretory cells

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-IV, C-II, D-I
• (3) A-I, B-III, C-II, D-IV
• (4) A-II, B-III, C-I, D-IV

Which of the following is not a steroid hormone?

• (1) Cortisol
• (2) Testosterone
• (3) Progesterone
• (4) Glucagon

Which of the following is not a component of Fallopian tube?

• (1) Uterine fundus
• (2) Isthmus
• (3) Infundibulum
• (4) Ampulla

Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:




Choose the correct answer from the options given below:

• (1) (a) Smooth - Toes, (b) Skeletal - Legs, (c) Cardiac - Heart
• (2) (a) Skeletal - Triceps, (b) Smooth - Stomach, (c) Cardiac - Heart
• (3) (a) Skeletal - Biceps, (b) Involuntary - Intestine, (c) Smooth - Heart
• (4) (a) Involuntary - Nose tip, (b) Skeletal - Bone, (c) Cardiac - Heart

Match List I with List II:

\begin{tabular{|c|p{4cm|c|p{6cm|
\hline
List I & & List II &

\hline
A. & Expiratory capacity & I. & Expiratory reserve volume + Tidal volume + Inspiratory reserve volume

B. & Functional residual capacity & II. & Tidal volume + Expiratory reserve volume

C. & Vital capacity & III. & Tidal volume + Inspiratory reserve volume

D. & Inspiratory capacity & IV. & Expiratory reserve volume + Residual volume

\hline
\end{tabular


Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-IV, C-I, D-III
• (4) A-III, B-II, C-IV, D-I

The flippers of the Penguins and Dolphins are the example of the:

• (1) Adaptive radiation
• (2) Natural selection
• (3) Convergent evolution
• (4) Divergent evolution

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List-I & \multicolumn{2{c|{List-II

\hline
A. & Lipase & I. & Peptide bond

B. & Nuclease & II. & Ester bond

C. & Protease & III. & Glycosidic bond

D. & Amylase & IV. & Phosphodiester bond

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-II, B-III, C-I, D-IV
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-I, C-III, D-II

The "Ti plasmid" of Agrobacterium tumefaciens stands for:

Choose the correct answer from the options given below:

• (1) Tumour inhibiting plasmid
• (2) Tumor independent plasmid
• (3) Tumor inducing plasmid
• (4) Temperature independent plasmid

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Axoneme & I. & Centriole

B. & Cartwheel pattern & II. & Cilia and flagella

C. & Crista & III. & Chromosome

D. & Satellite & IV. & Mitochondria

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-IV, B-II, C-III, D-I
• (3) A-II, B-IV, C-I, D-III
• (4) A-II, B-I, C-IV, D-III

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

Choose the correct answer from the options given below:

• (1) Genetic recombination
• (2) Genetic drift
• (3) Gene migration
• (4) Constant gene pool

Given below are two statements:

Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

% Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & \(\alpha\)-1 antitrypsin & I. & Cotton bollworm

B. & Cry IAb & II. & ADA deficiency

C. & Cry IAc & III. & Emphysema

D. & Enzyme replacement therapy & IV. & Corn borer

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-III, B-II, C-I, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-IV, C-I, D-III

Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below:

• (1) C-E-D-A-B
• (2) E-B-D-A-C
• (3) B-D-E-A-C
• (4) E-C-A-D-B

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

% Choose the correct answer from the options given below:

• (1) 5th segment
• (2) 10th segment
• (3) 8th and 9th segment
• (4) 11th segment

Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Down's syndrome & I. & 11^th chromosome

B. & \(\alpha\)-Thalassemia & II. & X chromosome

C. & \(\beta\)-Thalassemia & III. & 21^st chromosome

D. & Klinefelter's syndrome & IV. & 16^th chromosome

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-II, B-III, C-IV, D-I
• (2) A-II, B-IV, C-I, D-III
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-I, C-II, D-III

167. Which of the following is not a natural/traditional contraceptive method?

• (1) Coitus interruptus
• (2) Periodic abstinence
• (3) Lactational amenorrhea
• (4) Vaults

168. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Typhoid & I. & Fungus

B. & Leishmaniasis & II. & Nematode

C. & Ringworm & III. & Protozoa

D. & Filariasis & IV. & Bacteria

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-IV, B-III, C-I, D-II
• (3) A-III, B-I, C-IV, D-II
• (4) A-II, B-IV, C-III, D-I

169. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Pleurobrachia & I. & Mollusca

B. & Radula & II. & Ctenophora

C. & Stomochord & III. & Osteichthyes

D. & Air bladder & IV. & Hemichordata

\hline
\end{tabular

Choose the correct answer from the options given below :

• (1) A-IV, B-II, C-III, D-I
• (2) A-II, B-I, C-IV, D-III
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-III, C-II, D-I

170. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Common cold & I. & Plasmodium

B. & Haemozoin & II. & Typhoid

C. & Widal test & III. & Rhinoviruses

D. & Allergy & IV. & Dust mites

\hline
\end{tabular

Choose the correct answer from the options given below :

• (1) A-II, B-IV, C-III, D-I
• (2) A-II, B-III, C-II, D-IV
• (3) A-III, B-I, C-II, D-IV
• (4) A-IV, B-II, C-III, D-I

171. The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of 'X' and 'Y' genes:

• (1) The gene 'X' is responsible for resistance to antibiotics and 'Y' for protein involved in the replication of Plasmid.
• (2) The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid.
• (3) The gene 'X' is for protein involved in replication of Plasmid and 'Y' for resistance to antibiotics.
• (4) Gene 'X' is responsible for recognitions sites and 'Y' is responsible for antibiotic resistance.

172. Given below are two statements:


Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below :

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

173. Following are the stages of pathway for conduction of an action potential through the heart:

% List of Stages
A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of pathway from the options given below

• (1) E-C-A-D-B
• (2) A-E-C-B-D
• (3) B-D-E-C-A
• (4) E-A-D-B-C

174. Given below are some stages of human evolution. Arrange them in correct sequence (Past to Recent):

% List of Stages
A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus

Choose the correct sequence of human evolution from the options given below:

• (1) D-A-C-B
• (2) B-A-D-C
• (3) C-B-D-A
• (4) A-D-C-B

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

• (1) Low pCO\(_2\) and High H\(^+\) concentration
• (2) Low pCO\(_2\) and High temperature
• (3) High pO\(_2\) and High pCO\(_2\)
• (4) High pO\(_2\) and Lesser H\(^+\) concentration

176. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I (Sub Phases of Prophase I) & \multicolumn{2{c|{List II (Specific Characters)

\hline
A. & Diakinesis & I. & Synaptonemal complex formation

B. & Pachytene & II. & Completion of terminalisation of chiasmata

C. & Zygotene & III. & Chromosomes look like thin threads

D. & Leptotene & IV. & Appearance of recombination nodules

\hline
\end{tabular

Choose the correct answer from the options given below

• (1) A-IV, B-II, C-I, D-III
• (2) A-I, B-II, C-IV, D-III
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-III, C-II, D-I

177. Which of the following statements is incorrect?

• (A) A bio-reactor provides optimal growth conditions for achieving the desired product.
• (B) Most commonly used bio-reactors are of stirring type.
• (C) Bio-reactors are used to produce small scale bacterial cultures.
• (D) Bio-reactors have an agitator system, an oxygen delivery system, and foam control system.

178. Consider the following statements:


A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates

Choose the correct answer from the options given below :

• (1) B only
• (2) A only
• (3) C only
• (4) D only

179. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Non-medicated IUD & I. & Multiload 375

B. & Copper releasing IUD & II. & Progestogens

C. & Hormone releasing IUD & III. & Lippes loop

D. & Implants & IV. & LNG-20

\hline
\end{tabular

Choose the correct answer from the option given below:

• (1) A-III, B-I, C-IV, D-II
• (2) A-I, B-III, C-IV, D-II
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-I, C-IV, D-II

180. Which one is the correct product of DNA dependent RNA polymerase to the given template?

% DNA Template
DNA Template: 3'TACATGGCAAATATCCATTCA5'

• (1) 5'AUGUACCGUUUAAUGGUUAAG3'
• (2) 5'AUUGUAAAGUUUAUGGUAAGU3'
• (3) 5'AUUGUACCGUUUAAUGGGAAGU3'
• (4) 5'ATGTACCGTTTATAGGTAAGT3'

181. Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

% Assertion and Reason
Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

• (1) Both A and R are correct and R is the correct explanation of A
• (2) Both A and R are correct but R is NOT the correct explanation of A
• (3) A is correct but R is not correct
• (4) A is not correct but R is correct

182. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Fibrous joints & I. & Adjacent vertebrae, limited movement

B. & Cartilaginous joints & II. & Humerus and Pectoral girdle, rotational movement

C. & Hinge joints & III. & Skull, don't allow any movement

D. & Ball and socket joints & IV. & Knee, help in locomotion

\hline
\end{tabular

Choose the correct answer from the options given below :

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-III, C-I, D-IV
• (4) A-III, B-I, C-IV, D-II

183. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Pterophyllum & I. & Hag fish

B. & Myxine & II. & Saw fish

C. & Pristis & III. & Angel fish

D. & Exocoetus & IV. & Flying fish

\hline
\end{tabular

Choose the correct answer from the options given below :

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-II, C-I, D-IV

184. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Cocaine & I. & Effective sedative in surgery

B. & Heroin & II. & Cannabis sativa

C. & Morphine & III. & Erythroxylum

D. & Marijuana & IV. & Papaver somniferum

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-I, D-II
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-I, C-III, D-IV
• (4) A-III, B-IV, C-I, D-II

185. Which of the following are Autoimmune disorders?


A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the correct answer from the options given below:

• (1) A, B \& D only
• (2) A, B \& E only
• (3) B, C \& E only
• (4) C, D \& E only

186. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Exophthalmic goiter & I. & Excess secretion of cortisol, moon face \& hyperglycemia.

B. & Acromegaly & II. & Hypo-secretion of thyroid hormone and stunted growth.

C. & Cushing's syndrome & III. & Hyper secretion of thyroid hormone \& protruding eye balls.

D. & Cretinism & IV. & Excessive secretion of growth hormone.

\hline
\end{tabular

Choose the correct answer from the options given below :

• (1) A-I, B-III, C-II, D-IV
• (2) A-IV, B-II, C-I, D-III
• (3) A-III, B-IV, C-II, D-I
• (4) A-III, B-IV, C-I, D-II

187. Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis:

• (1) FSH, Leydig cells, Sertoli cells, spermiogenesis.
• (2) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
• (3) FSH, Sertoli cells, Leydig cells, spermatogenesis.
• (4) ICSH, Leydig cells, Sertoli cells, spermatogenesis.

188. Given below are two statements:


Statement I: Mitochondria and chloroplasts both have double membranes bound organelles.

Statement II: The inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

189. Given below are two statements:


Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

190. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & RNA polymerase III & I. & snRNPs

B. & Termination of transcription & II. & Promotor

C. & Splicing of Exons & III. & Rho factor

D. & TATA box & IV. & SnRNAs, tRNA

\hline
\end{tabular

Choose the correct answer from the options given below :

• (1) A-II, B-IV, C-I, D-III
• (2) A-III, B-II, C-IV, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-I, D-II

191. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Mesozoic Era & I. & Lower invertebrates

B. & Proterozoic Era & II. & Fish \& Amphibia

C. & Cenozoic Era & III. & Birds \& Reptiles

D. & Paleozoic Era & IV. & Mammals

\hline
\end{tabular

Choose the correct answer from the options given below :

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-I, B-II, C-IV, D-III
• (4) A-III, B-I, C-IV, D-II

192. As per ABO blood grouping system, the blood group of father is B\(^+\), mother is A\(^+\) and child is O\(^+\). Their respective genotype can be:

% Genotypes

\(|B^i|/|A^i|/ii\)
\(|B|B|/|A|A|/ii\)
\(|A|B/|iA|/|B^i|\)
\(|A^i|/|B^i|/|A^i|\)
\(i|B^i|/|A|/|A|B\)


Choose the most appropriate answer from the options given below :

• (1) A only
• (2) B only
• (3) C \& B only
• (4) D \& E only

193. Match List I with List II related to the digestive system of a cockroach:

\begin{tabular{|c|p{10cm|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & The structures used for storing of food & I. & Gizzard

B. & Ring of 6-8 blind tubules at junction of foregut and midgut & II. & Gastric Caeca

C. & Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut & III. & Malpighian tubules

D. & The structures used for grinding the food. & IV. & Crop

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-II, C-III, D-IV
• (3) A-IV, B-III, C-II, D-I
• (4) A-III, B-II, C-IV, D-I

194. Regarding catalytic cycle of an enzyme action, select the correct sequential steps:


A. Substrate enzyme complex formation

B. Free enzyme ready to bind with another substrate

C. Release of products

D. Chemical bonds of the substrate broken

E. Substrate binding to active site

• (1) E, A, D, C, B
• (2) A, E, B, D, C
• (3) B, A, C, D, E
• (4) E, D, C, B, A

195. The following are the statements about non-chordates:


A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

• (1) A \& C only
• (2) A, B \& D only
• (3) B, D \& E only
• (4) B, C \& D only

196. Given below are two statements:


Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

197. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & P wave & I. & Heart muscles are electrically silent.

B. & QRS complex & II. & Depolarisation of ventricles.

C. & T wave & III. & Depolarisation of atria.

D. & T-P gap & IV. & Repolarisation of ventricles.

\hline
\end{tabular

Choose the correct answer from the options given below :

• (1) A-I, B-III, C-IV, D-II
• (2) A-III, B-II, C-IV, D-I
• (3) A-II, B-III, C-I, D-IV
• (4) A-IV, B-II, C-I, D-III

198. Given below are two statements:


Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.


In the light of the above statements, choose the correct answer from the options given below :

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

199. Choose the correct statement given below regarding juxta medullary nephron.

• (1) Juxta medullary nephrons are located in the columns of Bertini.
• (2) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
• (3) Loop of Henle of juxta medullary nephron runs deep into medulla.
• (4) Juxta medullary nephrons outnumber the cortical nephrons.

200. Match List I with List II:

\begin{tabular{|c|l|c|l|
\hline
\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II

\hline
A. & Unicellular glandular epithelium & I. & Salivary glands

B. & Compound epithelium & II. & Pancreas

C. & Multicellular glandular epithelium & III. & Goblet cells of alimentary canal

D. & Endocrine glandular epithelium & IV. & Moist surface of buccal cavity

\hline
\end{tabular

Choose the correct answer from the options given below:

• (1) A-I, B-III, C-IV, D-II
• (2) A-III, B-II, C-I, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-II, C-I, D-III