NEET 2024 Question paper with answer key pdf S6 is available for download. NEET 2024 S6 question paper has been conducted by the NTA on May 5, 2024, in pen-paper mode. NEET 2024 question paper code S6 consists of 200 MCQs- 180 to be attempted in 200 minutes. Each of the 4 subjects (Zoology, Botany, Chemistry, Physics) in NEET S6 question paper 2023 have 50 MCQs (45 to be attempted). You can download NEET 2024 question paper with answer key with solutions PDF for S6 using the links given below.

Related Links:

NEET 2024 Question Paper with Answer Key PDF S6 in English

NEET 2024 Question Paper with Answer Key download iconDownload Check Solutions

NEET 2024 Question Paper With Solution 

Question 1:

Match List I with List II.





Choose the correct answer from the options given below:

  • (A) A-I, B-II, C-III, D-IV
  • (B) A-II, B-I, C-IV, D-III
  • (C) A-III, B-IV, C-II, D-I
  • (D) A-IV, B-III, C-I, D-II
Correct Answer: (C) A-III, B-IV, C-II, D-I
View Solution

Question 2:

Match List I with List II.




Choose the correct answer from the options given below:

  • (A) A-IV, B-III, C-II, D-I
  • (B) A-II, B-III, C-IV, D-I
  • (C) A-II, B-I, C-III, D-IV
  • (D) A-III, B-II, C-I, D-IV
Correct Answer: (B) A-II, B-III, C-IV, D-I
View Solution

Question 3:

In a uniform magnetic field of \(0.049 \, T\), a magnetic needle performs 20 complete oscillations in 5 seconds. The moment of inertia of the needle is \( 9.8 \times 10^{-6} \, kg \cdot m^2 \). If the magnitude of the magnetic moment of the needle is \( x \times 10^{-5} \, Am^2 \), then the value of \( x \) is:


  • (A) \(1280\pi^2\)
  • (B) \(5\pi^2\)
  • (C) \(128\pi^2\)
  • (D) \(50\pi^2\)
Correct Answer: (A) \( 1280\pi^2 \)
View Solution

Question 4:

An unpolarised light beam strikes a glass surface at Brewster's angle. Then:

  • (A) The reflected light will be completely polarised but the refracted light will be partially polarised.
  • (B) The reflected light will be partially polarised.
  • (C) The refracted light will be completely polarised.
  • (D) Both the reflected and refracted light will be completely polarised.
Correct Answer: (A) The reflected light will be completely polarised but the refracted light will be partially polarised.
View Solution

Question 5:

Consider the following statements A and B and identify the correct answer:





(A) For a solar cell, the I-V characteristics lie in the IV quadrant of the given graph.

(B) In a reverse biased \( pn \) junction diode, the current measured in (\(\mu A\)) is due to majority charge carriers.

  • (A) Both A and B are incorrect.
  • (B) A is correct but B is incorrect.
  • (C) A is incorrect but B is correct.
  • (D) Both A and B are correct.
Correct Answer: (B) A is correct but B is incorrect.
View Solution

Question 6:

A light ray enters through a right-angled prism at point \( P \) with the angle of incidence \( 30^\circ \) as shown in the figure. It travels through the prism parallel to its base \( BC \) and emerges along the face \( AC \). The refractive index of the prism is:



  • (A) \( \frac{\sqrt{3}}{2} \)
  • (B) \( \frac{\sqrt{5}}{4} \)
  • (C) \( \frac{\sqrt{5}}{2} \)
  • (D) \( \frac{\sqrt{3}}{4} \)
Correct Answer: (C) \( \frac{\sqrt{5}}{2} \)
View Solution

Question 7:

A particle moving with uniform speed in a circular path maintains:

  • (A) Varying velocity and varying acceleration
  • (B) Constant velocity
  • (C) Constant acceleration
  • (D) Constant velocity but varying acceleration
Correct Answer: (A) Varying velocity and varying acceleration
View Solution

Question 8:

The graph which shows the variation of \( \frac{1}{\lambda^2} \) and its kinetic energy, \( E \) (where \( \lambda \) is de Broglie wavelength of a free particle):

  • (A)
  • (B)
  • (C)
  • (D)
Correct Answer: (A)
View Solution

Question 9:

A wire of length \( l \) and resistance \( 100 \Omega \) is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

  • (A) \( 60 \Omega \)
  • (B) \( 26 \Omega \)
  • (C) \( 52 \Omega \)
  • (D) \( 55 \Omega \)
Correct Answer: (C) \( 52 \Omega \)
View Solution

Question 10:

The moment of inertia of a thin rod about an axis passing through its midpoint and perpendicular to the rod is \( 2400 \, cm^2 \). The length of the 400 g rod is nearly:

  • (A) \( 72.0 \) cm
  • (B) \( 8.5 \) cm
  • (C) \( 17.5 \) cm
  • (D) \( 20.7 \) cm
Correct Answer: (B) \( 8.5 \) cm
View Solution

Question 11:

The output (Y) of the given logic gate is similar to the output of an/a



  • (A) AND gate
  • (B) NAND gate
  • (C) NOR gate
  • (D) OR gate
Correct Answer: (A) AND gate
View Solution

Question 12:

In a vernier calipers, \( (N+1) \) divisions of the vernier scale coincide with \( N \) divisions of the main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:

  • (A) \( 10(N+1) \)
  • (B) \( \frac{1}{10N} \)
  • (C) \( \frac{1}{100(N+1)} \)
  • (D) \( 100N \)
Correct Answer: (C) \( \frac{1}{100(N+1)} \)
View Solution

Question 13:

At any instant of time \( t \), the displacement of any particle is given by \( 2t - 1 \) (SI unit) under the influence of force of 5 N. The value of instantaneous power is (in SI unit):

  • (A) \( 6 \)
  • (B) \( 10 \)
  • (C) \( 5 \)
  • (D) \( 7 \)
Correct Answer: (B) 10 \newpage
View Solution

Question 14:

A thin spherical shell is charged by some source. The potential difference between the two points \( C \) and \( P \) (in V) shown in the figure is:







(Take \( \frac{1}{4\pi\varepsilon_0} = 9 \times 10^9 \) SI units)

  • (A) Zero
  • (B) \( 3 \times 10^5 \)
  • (C) \( 1 \times 10^5 \)
  • (D) \( 0.5 \times 10^5 \)
Correct Answer: (A) Zero
View Solution

Question 15:

A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is \( 0.07 \) N m\(^{-1}\), then the excess force required to take it away from the surface is:

  • (A) \( 99 \) N
  • (B) \( 19.8 \) mN
  • (C) \( 198 \) N
  • (D) \( 1.98 \) mN
Correct Answer: (B) \( 19.8 \) mN
View Solution

Question 16:

A logic circuit provides the output \( Y \) as per the following truth table:



\begin{tabular{|c|c|c|
\hline \( A \) & \( B \) & \( Y \)

\hline
0 & 0 & 1

0 & 1 & 0

1 & 0 & 0

1 & 1 & 0

\hline
\end{tabular

  • (A) \( B \)
  • (B) \( A.B + \overline{A} \)
  • (C) \( A.\overline{B} + \overline{A} \)
  • (D) \( \overline{B} \)
Correct Answer: (D) \( \overline{B} \)
View Solution

Question 17:

Given below are two statements: one is labelled as \textbf{Assertion A} and the other is labelled as \textbf{Reason R}.


Assertion A: The potential (\(V\)) at any axial point, at 2 m distance (\(r\)) from the centre of the dipole of dipole moment vector \( P \) of magnitude, \( 4 \times 10^{-6} \) C m, is \( \pm 9 \times 10^3 \) V.


(Take \( \frac{1}{4\pi\varepsilon_0} = 9 \times 10^9 \) SI units)


Reason R: The potential at an axial point of a dipole is given by:
\[ V = \pm \frac{2P}{4\pi\varepsilon_0 r^2} \]

where \( r \) is the distance of any axial point, situated at 2 m from the centre of the dipole.


In the light of the above statements, choose the correct answer from the options given below:

  • (A) A is false but R is true.
  • (B) Both A and R are true and R is the correct explanation of A.
  • (C) Both A and R are true and R is NOT the correct explanation of A.
  • (D) A is true but R is false.
Correct Answer: (D) A is true but R is false.
View Solution

Question 18:

The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 \( \Omega \), when connected through an external resistance of 4 \( \Omega \) as shown in the figure is:



  • (A) \( 10 \) V
  • (B) \( 4 \) V
  • (C) \( 6 \) V
  • (D) \( 8 \) V
Correct Answer: (D) \( 8 \) V
View Solution

Question 19:

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:






\newpage

  • (A) BA and DC
  • (B) AB and DC
  • (C) BA and CD
  • (D) AB and CD
Correct Answer: (B) AB and DC
View Solution

Question 20:

In an ideal transformer, the turns ratio is \( \frac{N_p}{N_s} = \frac{1}{2} \). The ratio \( V_S : V_P \) is equal to (the symbols carry their usual meaning):

  • (A) \( 1:4 \)
  • (B) \( 1:2 \)
  • (C) \( 2:1 \)
  • (D) \( 1:1 \)
Correct Answer: (C) \( 2:1 \)
View Solution

Question 21:

A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as \( 4\pi \times 10^{-7} \) SI units):

  • (A) \( 44 \) T
  • (B) \( 44 \) mT
  • (C) \( 4.4 \) T
  • (D) \( 4.4 \) mT
Correct Answer: (D) \( 4.4 \) mT
View Solution

Question 22:

Given below are two statements:


Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.

\smallskip
Statement II: Atoms of each element are stable and emit their characteristic spectrum.


In the light of the above statements, choose the most appropriate answer from the options given below:

  • (A) Statement I is incorrect but Statement II is correct.
  • (B) Both Statement I and Statement II are correct.
  • (C) Both Statement I and Statement II are incorrect.
  • (D) Statement I is correct but Statement II is incorrect.
Correct Answer: (D) Statement I is correct but Statement II is incorrect.
View Solution

Question 23:

The quantities which have the same dimensions as those of solid angle are:

  • (A) angular speed and stress
  • (B) strain and angle
  • (C) stress and angle
  • (D) strain and arc
Correct Answer: (B) strain and angle
View Solution

Question 24:

If \( c \) is the velocity of light in free space, the correct statements about photon among the following are:


(A) The energy of a photon is \( E = h\nu \).

(B) The velocity of a photon is \( c \).

(C) The momentum of a photon, \( p = \frac{h\nu}{c} \).

(D) In a photon-electron collision, both total energy and total momentum are conserved.

(E) Photon possesses positive charge.



Choose the correct answer from the options given below:

  • (A) A, B, D and E only
  • (B) A and B only
  • (C) A, B, C and D only
  • (D) A, C and D only
Correct Answer: (C) A, B, C and D only
View Solution

Question 25:

A bob is whirled in a horizontal plane by means of a string with an initial speed of \( \omega \) rpm. The tension in the string is \( T \). If speed becomes \( 2\omega \) while keeping the same radius, the tension in the string becomes:

  • (A) \( \sqrt{2}T \)
  • (B) \( T \)
  • (C) \( 4T \)
  • (D) \( \frac{T}{4} \)
Correct Answer: (C) \( 4T \)
View Solution

Question 26:

If \( x = 5 \sin \left( \pi t + \frac{\pi}{3} \right) \) m represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are:

  • (A) \( 5 \) m, \( 1 \) s
  • (B) \( 5 \) cm, \( 2 \) s
  • (C) \( 5 \) m, \( 2 \) s
  • (D) \( 5 \) cm, \( 1 \) s
Correct Answer: (C) \( 5 \) m, \( 2 \) s
View Solution

Question 27:

A thermodynamic system is taken through the cycle \( abcd \). The work done by the gas along the path \( bc \) is:


  • (A) \( -60 \) J
  • (B) Zero
  • (C) \( 30 \) J
  • (D) \( -90 \) J
Correct Answer: (B) Zero
View Solution

Question 28:

In the nuclear emission stated below, the mass number and atomic number of the product \( Q \) respectively, are:
\[ ^{290}_{82}X \xrightarrow{\alpha} Y \xrightarrow{e^+} Z \xrightarrow{\beta^-} P \xrightarrow{e^-} Q \]

  • (A) \( 286, 81 \)
  • (B) \( 280, 81 \)
  • (C) \( 286, 80 \)
  • (D) \( 288, 82 \)
Correct Answer: (A) \( 286, 81 \)
View Solution

Question 29:

Two bodies \( A \) and \( B \) of same mass undergo completely inelastic one-dimensional collision. The body \( A \) moves with velocity \( v_1 \) while body \( B \) is at rest before collision. The velocity of the system after collision is \( v_2 \). The ratio \( v_1 : v_2 \) is:

  • (A) \( 1:4 \)
  • (B) \( 1:2 \)
  • (C) \( 2:1 \)
  • (D) \( 4:1 \)
Correct Answer: (C) \( 2:1 \)
View Solution

Question 30:

In the following circuit, the equivalent capacitance between terminal \( A \) and terminal \( B \) is:



  • (A) \( 4 \,\mu F \)
  • (B) \( 2 \,\mu F \)
  • (C) \( 1 \,\mu F \)
  • (D) \( 0.5 \,\mu F \)
Correct Answer: (B) \( 2 \,\mu F \)
View Solution

Question 31:

A horizontal force 10 N is applied to a block \( A \) as shown in the figure. The mass of blocks \( A \) and \( B \) are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block \( A \) on block \( B \) is:



  • (A) \( 10 \) N
  • (B) \( 0 \)
  • (C) \( 4 \) N
  • (D) \( 6 \) N
Correct Answer: (D) \( 6 \) N
View Solution

Question 32:

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \( v \) in the direction shown, which one of the following options is correct (P and Q are the highest and lowest points on the wheel, respectively)?



  • (A) Point \( P \) has zero speed
  • (B) Point \( P \) moves slower than point \( Q \)
  • (C) Point \( P \) moves faster than point \( Q \)
  • (D) Both points \( P \) and \( Q \) move with equal speed
Correct Answer: (C) Point \( P \) moves faster than point \( Q \) \newpage
View Solution

Question 33:

The mass of a planet is \( \frac{1}{10} \)th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:

  • (A) \( 3.92 \) m s\(^{-2}\)
  • (B) \( 19.6 \) m s\(^{-2}\)
  • (C) \( 9.8 \) m s\(^{-2}\)
  • (D) \( 4.9 \) m s\(^{-2}\)
Correct Answer: (A) \( 3.92 \) m s\(^{-2}\)
View Solution

Question 34:

The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus, respectively, are \( 8 \times 10^8 \) N m\(^{-2}\) and \( 2 \times 10^{11} \) N m\(^{-2}\), is:

  • (A) \( 8 \) mm
  • (B) \( 4 \) mm
  • (C) \( 0.4 \) mm
  • (D) \( 40 \) mm
Correct Answer: (B) \( 4 \) mm
View Solution

Question 35:

If the monochromatic source in Young’s double slit experiment is replaced by white light, then:

  • (A) All bright fringes will be of equal width
  • (B) Interference pattern will disappear
  • (C) There will be a central dark fringe surrounded by a few coloured fringes
  • (D) There will be a central bright white fringe surrounded by a few coloured fringes
Correct Answer: (D) There will be a central bright white fringe surrounded by a few coloured fringes
View Solution

Question 36:

A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object is:

  • (A) \( 32 \)
  • (B) \( 34 \)
  • (C) \( 28 \)
  • (D) \( 17 \)
Correct Answer: (C) \( 28 \)
View Solution

Question 37:

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then:


(A) The charge stored in it, increases.

(B) The energy stored in it, decreases.

(C) Its capacitance increases.

(D) The ratio of charge to its potential remains the same.

(E) The product of charge and voltage increases.



Choose the most appropriate answer from the options given below:

  • (A) A, B and C only
  • (B) A, B and E only
  • (C) A, C and E only
  • (D) B, D and E only
Correct Answer: (C) A, C and E only
View Solution

Question 38:

A 10 \(\mu\)F capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is nearly (\(\pi = 3.14\)):



  • (A) \( 0.35 \) A
  • (B) \( 0.58 \) A
  • (C) \( 0.93 \) A
  • (D) \( 1.20 \) A
Correct Answer: (C) \( 0.93 \) A
View Solution

Question 39:

Choose the correct circuit which can achieve the bridge balance.

  • (A)
  • (B)
  • (C)
  • (D)
Correct Answer: (B)
View Solution

Question 40:

Two heaters \( A \) and \( B \) have power ratings of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

  • (A) \( 2:3 \)
  • (B) \( 1:1 \)
  • (C) \( 2:9 \)
  • (D) \( 1:2 \)
Correct Answer: (C) \( 2:9 \)
View Solution

Question 41:

The velocity (\( v \)– time (\( t \)) plot of the motion of a body is shown below:







The acceleration (\( a \) – time (\( t \)) graph that best suits this motion is:

  • (A)
  • (B)
  • (C)
  • (D)
Correct Answer: (D)
View Solution

Question 42:

If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is \( \frac{x}{2} \) times its original time period. Then the value of \( x \) is:

  • (A) \( 4 \)
  • (B) \( \sqrt{3} \)
  • (C) \( \sqrt{2} \)
  • (D) \( 2\sqrt{3} \)
Correct Answer: (C) \( \sqrt{2} \)
View Solution

Question 43:

A metallic bar of Young’s modulus, \( 0.5 \times 10^{11} \) N m\(^{-2}\) and coefficient of linear thermal expansion \( 10^{-5} \)°C\(^{-1}\), length 1 m and area of cross-section \( 10^{-3} \) m\(^2\) is heated from \( 0^\circ C \) to \( 100^\circ C \) without expansion or bending. The compressive force developed in it is:

  • (A) \( 2 \times 10^3 \) N
  • (B) \( 5 \times 10^3 \) N
  • (C) \( 50 \times 10^3 \) N
  • (D) \( 100 \times 10^3 \) N
Correct Answer: (C) \( 50 \times 10^3 \) N
View Solution

Question 44:

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:


(A) Hold the sheet there if it is magnetic.

(B) Hold the sheet there if it is non-magnetic.

(C) Move the sheet away from the pole with uniform velocity if it is conducting.

(D) Move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.



Choose the correct statement(s) from the options given below:

  • (A) C only
  • (B) B and D only
  • (C) A and C only
  • (D) A, C and D only
Correct Answer: (C) A and C only \newpage
View Solution

Question 45:

The property which is \textbf{not} of an electromagnetic wave travelling in free space is:

  • (A) They originate from charges moving with uniform speed
  • (B) They are transverse in nature
  • (C) The energy density in electric field is equal to energy density in magnetic field
  • (D) They travel with a speed equal to \( \frac{1}{\sqrt{\mu_0 \varepsilon_0}} \)
Correct Answer: (A) They originate from charges moving with uniform speed
View Solution

Question 46:

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If \( I \) is the current in the circuit, then in the gap between the plates:

  • (A) Displacement current of magnitude greater than \( I \) flows but can be in any direction
  • (B) There is no current
  • (C) Displacement current of magnitude equal to \( I \) flows in the same direction as \( I \)
  • (D) Displacement current of magnitude equal to \( I \) flows in a direction opposite to that of \( I \)
Correct Answer: (C) Displacement current of magnitude equal to \( I \) flows in the same direction as \( I \)
View Solution

Question 47:

An iron bar of length \( L \) has magnetic moment \( M \). It is bent at the middle of its length such that the two arms make an angle \( 60^\circ \) with each other. The magnetic moment of this new magnet is:

  • (A) \( \frac{M}{\sqrt{3}} \)
  • (B) \( M \)
  • (C) \( \frac{M}{2} \)
  • (D) \( 2M \)
Correct Answer: (C) \( \frac{M}{2} \)
View Solution

Question 48:

The minimum energy required to launch a satellite of mass \( m \) from the surface of earth of mass \( M \) and radius \( R \) in a circular orbit at an altitude of \( 2R \) from the surface of the earth is:

  • (A) \( \frac{GmM}{3R} \)
  • (B) \( \frac{5GmM}{6R} \)
  • (C) \( \frac{2GmM}{3R} \)
  • (D) \( \frac{GmM}{2R} \)
Correct Answer: (B) \( \frac{5GmM}{6R} \)
View Solution

Question 49:

The following graph represents the \( T-V \) curves of an ideal gas (where \( T \) is the temperature and \( V \) the volume) at three pressures \( P_1, P_2 \) and \( P_3 \) compared with those of Charles’s law represented as dotted lines.



  • (A) \( P_1 > P_2 > P_3 \)
  • (B) \( P_3 > P_2 > P_1 \)
  • (C) \( P_3 > P_1 > P_2 \)
  • (D) \( P_2 > P_1 > P_3 \)
Correct Answer: (A) \( P_1 > P_2 > P_3 \)
View Solution

Question 50:

A force defined by \( F = \alpha t + \beta t \) acts on a particle at a given time \( t \). The factor which is dimensionless, if \( \alpha \) and \( \beta \) are constants, is:

  • (A) \( \frac{\alpha \beta}{t} \)
  • (B) \( \frac{\beta t}{\alpha} \)
  • (C) \( \frac{\alpha t}{\beta} \)
  • (D) \( \alpha \beta t \)
Correct Answer: (C) \( \frac{\alpha t}{\beta} \)
View Solution

Question 51:

Given below are two statements:

Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.

Statement II: Aniline cannot be prepared through Gabriel synthesis.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Statement I is incorrect but Statement II is true
  • (2) Both Statement I and Statement II are true
  • (3) Both Statement I and Statement II are false
  • (4) Statement I is correct but Statement II is false
Correct Answer: (2) Both Statement I and Statement II are true.
View Solution

Question 52:

Match List I with List II.







Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-IV, D-I
  • (2) A-I, B-IV, C-II, D-III
  • (3) A-II, B-IV, C-III, D-I
  • (4) A-III, B-IV, C-I, D-II
Correct Answer: (2) A-I, B-IV, C-II, D-III.
View Solution

Question 53:

Match List I with List II.







Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-I, D-II
  • (2) A-I, B-IV, C-II, D-III
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-III, B-IV, C-II, D-I
Correct Answer: (4) A-III, B-IV, C-II, D-I.
View Solution

Question 54:

For the reaction \( 2A \rightleftharpoons B + C \), \( K_C = 4 \times 10^{-3} \). At a given time, the composition of reaction mixture is \([A] = [B] = [C] = 2 \times 10^{-3} M\).

Then, which of the following is correct?

  • (1) Reaction has gone to completion in forward direction.
  • (2) Reaction is at equilibrium.
  • (3) Reaction has a tendency to go in forward direction.
  • (4) Reaction has a tendency to go in backward direction.
Correct Answer: (4) Reaction has a tendency to go in backward direction.
View Solution

Question 55:

Match List I with List II.








Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-IV, D-I
  • (2) A-IV, B-III, C-II, D-I
  • (3) A-IV, B-II, C-III, D-I
  • (4) A-I, B-II, C-III, D-IV
Correct Answer: (1) A-II, B-III, C-IV, D-I.
View Solution

Question 56:

Match List I with List II.







Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-IV, D-III
  • (2) A-I, B-II, C-III, D-IV
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-III, B-IV, C-II, D-I
Correct Answer: (3) A-III, B-IV, C-I, D-II.
View Solution

Question 57:

Arrange the following elements in increasing order of first ionization enthalpy:

Li, Be, B, C, N


Choose the correct answer from the options given below:

  • (1) Li \(<\) Be \(<\) N \(<\) B \(<\) C
  • (2) Li \(<\) Be \(<\) C \(<\) N \(<\) B
  • (3) Li \(<\) B \(<\) Be \(<\) C \(<\) N
  • (4) Li \(<\) Be \(<\) C \(<\) B \(<\) N
Correct Answer: (3) Li \(<\) B \(<\) Be \(<\) C \(<\) N.
View Solution

Question 58:

Among Group 16 elements, which one does NOT show \(-2\) oxidation state?

  • (1) Po
  • (2) O
  • (3) Se
  • (4) Te
Correct Answer: (1) Po.
View Solution

Question 59:

In which of the following equilibria, \( K_p \) and \( K_c \) are NOT equal?

  • (1) \( 2BrCl_{(g)} \rightleftharpoons Br_{2(g)} + Cl_{2(g)} \)
  • (2) \( PCl_{5(g)} \rightleftharpoons PCl_{3(g)} + Cl_{2(g)} \)
  • (3) \( H_{2(g)} + I_{2(g)} \rightleftharpoons 2H I_{(g)} \)
  • (4) \( CO_{(g)} + H_2O_{(g)} \rightleftharpoons CO_2_{(g)} + H_2_{(g)} \)
Correct Answer: (2) \( PCl_{5(g)} \rightleftharpoons PCl_{3(g)} + Cl_{2(g)} \).
View Solution

Question 60:

The reagents with which glucose does NOT react to give the corresponding tests/products are:


(A) Tollen’s reagent

(B) Schiff’s reagent

(C) HCN

(D) \( NH_2OH \)

(E) \( NaHSO_3 \)

Choose the correct options from the given below:

  • (1) E and D
  • (2) B and C
  • (3) A and D
  • (4) B and E
Correct Answer: (4) B and E.
View Solution

Question 61:

Identify the correct reagents that would bring about the following transformation.


  • (1) (i) \( H_2O/H^+ \)
    \hspace{0.6cm}(ii) PCC
  • (2) (i) \( H_2O/H^+ \)
    \hspace{0.6cm}(ii) \( CrO_3 \)
  • (3) (i) \( BH_3 \)
    \hspace{0.6cm}(ii) \( H_2O_2/OH^- \)
    \hspace{0.6cm}(iii) PCC
  • (4) (i) \( BH_3 \)
    \hspace{0.6cm}(ii) \( H_2O_2/OH^- \)
    \hspace{0.6cm}(iii) \( alk. KMnO_4 \)
    \hspace{0.6cm}(iv) \( H_3O^+ \)
Correct Answer: (3) (i) \( BH_3 \)
\hspace{4.1cm}(ii) \( H_2O_2/OH^- \)
\hspace{4.1cm}(iii) PCC
\newpage
View Solution

Question 62:

The \( E^\circ \) value for the Mn\(^3+\)/Mn\(^2+\) couple is more positive than that of Cr\(^3+\)/Cr\(^2+\) or Fe\(^3+\)/Fe\(^2+\) due to change of:

  • (1) \( d^3 \) to \( d^5 \) configuration
  • (2) \( d^5 \) to \( d^4 \) configuration
  • (3) \( d^5 \) to \( d^2 \) configuration
  • (4) \( d^4 \) to \( d^5 \) configuration
Correct Answer: (4) \( d^4 \) to \( d^5 \) configuration.
View Solution

Question 63:

Given below are two statements:

Statement I: Both [Co(NH\(_3\))\(_6\)]\(^3+\) and [CoF\(_6\)]\(^3-\) complexes are octahedral but differ in their magnetic behavior.

Statement II: [Co(NH\(_3\))\(_6\)]\(^3+\) is diamagnetic whereas [CoF\(_6\)]\(^3-\) is paramagnetic.

Choose the correct answer from the options given below:

  • (1) Statement I is false but Statement II is true
  • (2) Both Statement I and Statement II are true
  • (3) Both Statement I and Statement II are false
  • (4) Statement I is true but Statement II is false
Correct Answer: (2) Both Statement I and Statement II are true.
View Solution

Question 64:

Fehling’s solution 'A' is:

  • (1) Aqueous sodium citrate
  • (2) Aqueous copper sulphate
  • (3) Alkaline copper sulphate
  • (4) Alkaline solution of sodium potassium tartrate (Rochelle’s salt)
Correct Answer: (2) Aqueous copper sulphate.
View Solution

Question 65:

In which of the following processes entropy increases?


(A) A liquid evaporates to vapor.

(B) Temperature of a crystalline solid is lowered from 130 K to 0 K.

(C) \( 2NaHCO_3(s) \rightarrow Na_2CO_3(s) + CO_2(g) + H_2O(g) \)

(D) \( Cl_2(g) \rightarrow 2Cl(g) \)


Choose the correct answer from the options given below:

  • (1) C and D
  • (2) A and C
  • (3) A and B
  • (4) A, C and D
Correct Answer: (4) A, C and D.
View Solution

Question 66:

The energy of an electron in the ground state (\( n = 1 \)) for He\(^+\) ion is \(-x\) J. Then, for an electron in \( n = 2 \) state for Be\(^{3+}\) ion, the energy in J is:

  • (1) \(-\frac{4}{9}x\)
  • (2) \(-x\)
  • (3) \(-\frac{x}{9}\)
  • (4) \(-4x\)
Correct Answer: (2) \(-x\).
View Solution

Question 67:

Match List I with List II.






Choose the correct answer from the options given below:

  • (1) A-I, B-IV, C-II, D-III
  • (2) A-IV, B-I, C-III, D-II
  • (3) A-III, B-I, C-II, D-IV
  • (4) A-IV, B-I, C-II, D-III
Correct Answer: (4) A-IV, B-I, C-II, D-III.
View Solution

Question 68:

Activation energy of any chemical reaction can be calculated if one knows the value of:

  • (1) Rate constant at two different temperatures
  • (2) Rate constant at standard temperature
  • (3) Probability of collision
  • (4) Orientation of reactant molecules during collision
Correct Answer: (1) Rate constant at two different temperatures.
View Solution

Question 69:

The most stable carbocation among the following is:

  • (1)
  • (2)
  • (3)
  • (4)
Correct Answer: (1)
View Solution

Question 70:

Given below are two statements:

Statement I: The boiling point of three isomeric pentanes follows the order \[ n-pentane > isopentane > neopentane \]

Statement II: When branching increases, the molecule attains a spherical shape, reducing surface area for contact and weakening intermolecular forces, thereby lowering the boiling point.

Choose the most appropriate answer:

  • (1) Statement I is incorrect but Statement II is correct
  • (2) Both Statement I and Statement II are correct
  • (3) Both Statement I and Statement II are incorrect
  • (4) Statement I is correct but Statement II is incorrect
Correct Answer: (2) Both Statement I and Statement II are correct.
View Solution

Question 71:

Which one of the following alcohols reacts instantaneously with Lucas reagent?

  • (1)
  • (2)
  • (3)
  • (4)
Correct Answer: (1)
View Solution

Question 72:

The Henry’s law constant (\( K_H \)) values of three gases (A, B, C) in water are 145, \( 2 \times 10^{-5} \), and 35 kbar, respectively. The solubility of these gases in water follows the order:

  • (1) A \(>\) B \(>\) C
  • (2) B \(>\) A \(>\) C
  • (3) B \(>\) C \(>\) A
  • (4) A \(>\) C \(>\) B
Correct Answer: (3) B \(>\) C \(>\) A.
View Solution

Question 73:

Which plot of \( \ln k \) vs \( \frac{1}{T} \) is consistent with the Arrhenius equation?

  • (1)
  • (2)
  • (3)
  • (4)
Correct Answer: (1)
View Solution

Question 74:

On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as

  • (A) Chromatography
  • (B) Crystallization
  • (C) Sublimation
  • (D) Distillation
Correct Answer: (3) Sublimation.
View Solution

Question 75:

Intramolecular hydrogen bonding is present in

  • (1) HF
  • (2)
  • (3)
  • (4)
Correct Answer: (2) Ortho-Nitrophenol.
View Solution

Question 76:

1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to:

  • (A) 200 mg
  • (B) 750 mg
  • (C) 250 mg
  • (D) Zero mg
Correct Answer: (3) 250 mg.
View Solution

Question 77:

Which reaction is NOT a redox reaction?

  • (A) BaCl_2 + Na_2SO_4 \rightarrow BaSO_4 + 2NaCl \quad (Correct Answer)
  • (B) Zn + CuSO_4 \rightarrow ZnSO_4 + Cu
  • (C) 2KClO_3 + I_2 \rightarrow 2KIO_3 + Cl_2
  • (D) H_2 + Cl_2 \rightarrow 2HCl
Correct Answer: (1) BaCl\(_2\) + Na\(_2\)SO\(_4\) \(\rightarrow\) BaSO\(_4\) + 2NaCl.
View Solution

Question 78:

‘Spin only’ magnetic moment is same for which of the following ions?


(A) \text{Ti^{3+

(B) \text{Cr^{2+

(C) \text{Mn^{2+

(D) \text{Fe^{2+

(E) \text{Sc^{3+

Choose the most appropriate answer from the options given below:

  • (1) A and D only
  • (2) B and D only
  • (3) A and E only
  • (4) B and C only
Correct Answer: (2) B and D only
View Solution

Question 79:

The highest number of helium atoms is in

  • (1) 2.271098 L of helium at STP
  • (2) 4 mol of helium
  • (3) 4 u of helium
  • (4) 4 g of helium
Correct Answer: (2) 4 mol of helium
View Solution

Question 80:

Match List I with List II.






Choose the correct answer from the options given below:

  • (1) A-II, B-IV, C-III, D-I
  • (2) A-II, B-III, C-IV, D-I
  • (3) A-I, B-III, C-IV, D-II
  • (4) A-I, B-IV, C-III, D-II
Correct Answer: (2) A-II, B-III, C-IV, D-I
View Solution

Question 81:

Given below are two statements:

Statement I: The boiling point of hydrides of Group 16 elements follows the order \[ H_2O > H_2Te > H_2Se > H_2S. \]

Statement II: On the basis of molecular mass, H\(_2\)O is expected to have a lower boiling point than the other members of the group, but due to the presence of extensive H-bonding in H\(_2\)O, it has a higher boiling point.


In the light of the above statements, choose the correct answer from the options given below:

  • (1) Statement I is false but Statement II is true
  • (2) {Both Statement I and Statement II are true
  • (3) Both Statement I and Statement II are false
  • (4) Statement I is true but Statement II is false
Correct Answer: (2) Both Statement I and Statement II are true
View Solution

Question 82:

A compound with a molecular formula of C\(_6\)H\(_{14}\) has two tertiary carbons. Its IUPAC name is:


Choose the correct answer from the options given below:

  • (1) 2,2-dimethylbutane
  • (2) n-hexane
  • (3) 2-methylpentane
  • (4) \textbf{2,3-dimethylbutane }
Correct Answer: (4) 2,3-dimethylbutane
View Solution

Question 83:

Match List I with List II.


  • (1) A-III, B-IV, C-II, D-I
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-II, B-III, C-I, D-IV
Correct Answer: (2) A-II, B-IV, C-I, D-III
View Solution

Question 84:

The compound that will undergo S\(_N\)1 reaction with the fastest rate is:

  • (1)
  • (2)
  • (3)
  • (4)
Correct Answer: (1)
View Solution

Question 85:

Arrange the following elements in increasing order of electronegativity:

N, O, F, C, Si

Choose the correct answer from the options given below:

  • (A) \( F < O < N < C < Si \)
  • (B) \( Si < C < N < O < F \)
  • (C) \( Si < C < O < N < F \)
  • (D) \( O < F < N < C < Si \)
Correct Answer: (2) \( Si < C < N < O < F \)
View Solution

Question 86:

Major products A and B formed in the following reaction sequence, are:


  • (A)
  • (B)
  • (C)
  • (D)
Correct Answer: (2)
View Solution

Question 87:

Identify the correct answer.

  • (A) Three canonical forms can be drawn for \( CO_3^{2-} \) ion
  • (B) Three resonance structures can be drawn for ozone
  • (C) \( BF_3 \) has non-zero dipole moment
  • (D) Dipole moment of \( NF_3 \) is greater than that of \( NH_3 \)
Correct Answer: (1) Three canonical forms can be drawn for \( CO_3^{2-} \) ion
View Solution

Question 88:

The work done during reversible isothermal expansion of one mole of hydrogen gas at \(25^\circ\) C from a pressure of 20 atmosphere to 10 atmosphere is

(Given \( R = 2.0 \) cal \( K^{-1} \) mol\(^{-1} \))

  • (A) 100 calories
  • (B) 0 calorie
  • (C) \(-413.14\) calories
  • (D) 413.14 calories
Correct Answer: (3) \(-413.14\) calories
View Solution

Question 89:

Consider the following reaction in a sealed vessel at equilibrium with given concentrations:
\[ N_2 = 3.0 \times 10^{-3} M, \quad O_2 = 4.2 \times 10^{-3} M, \quad NO = 2.8 \times 10^{-3} M. \]
\[ 2NO_{(g)} \rightleftharpoons N_2_{(g)} + O_2_{(g)} \]

If 0.1 mol L\(^{-1}\) of NO\(_{(g)}\) is taken in a closed vessel, determine the degree of dissociation (\(\alpha\)) at equilibrium.

  • (A) \(0.717\)
  • (B) \(0.00889\)
  • (C) \(0.0889\)
  • (D) \(0.8889\)
Correct Answer: (1) \(0.717\)
View Solution

Question 90:

For the given reaction:



  • (1)
  • (2)
  • (3)
  • (4)
Correct Answer: (3) Cyclohexyl carboxylic acid.
View Solution

Question 91:

The pair of lanthanoid ions which are diamagnetic is:

  • (1) Pm\(^3+\) and Sm\(^3+\)
  • (2) Ce\(^4+\) and Yb\(^2+\)
  • (3) Ce\(^3+\) and Eu\(^2+\)
  • (4) Gd\(^3+\) and Eu\(^3+\)
Correct Answer: (2) Ce\(^4+\) and Yb\(^2+\).
View Solution

Question 92:

The products A and B obtained in the following reactions, respectively, are:
\[ 3ROH + PCl_3 \rightarrow 3RCl + A \] \[ ROH + PCl_5 \rightarrow RCl + HCl + B \]

  • (1) H\(_3\)PO\(_3\) and PCl\(_3\)
  • (2) PCl\(_3\) and H\(_3\)PO\(_3\)
  • (3) POCl\(_3\) and H\(_3\)PO\(_4\)
  • (4) H\(_3\)PO\(_4\) and PCl\(_3\)
Correct Answer: (1) H\(_3\)PO\(_3\) and PCl\(_3\).
View Solution

Question 93:

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.


(A) Al\(^3+\)

(B) Cu\(^2+\)

(C) Ba\(^2+\)

(D) Co\(^2+\)

(E) Mg\(^2+\)

Choose the correct answer from the options given below:

  • (1) E, A, B, C, D
  • (2) B, A, D, C, E
  • (3) B, C, A, D, E
  • (4) E, C, D, B, A
Correct Answer: (2) B, A, D, C, E.
View Solution

Question 94:

Given below are two statements:

Statement I: \([Co(NH_3)_6]^{3+}\) is a homoleptic complex, whereas \([Co(NH_3)_4Cl_2]^{+}\) is a heteroleptic complex.

Statement II: Complex \([Co(NH_3)_6]^{3+}\) has only one kind of ligands but \([Co(NH_3)_4Cl_2]^{+}\) has more than one kind of ligands.

In light of the above statements, choose the \textit{correct answer from the options given below.

  • (A) Statement I is false, but Statement II is true
  • (B) Both Statement I and Statement II are true
  • (C) Both Statement I and Statement II are false
  • (D) Statement I is true, but Statement II is false
Correct Answer: (2) \text{Both Statement I and Statement II are true}
View Solution

Question 95:

A compound X contains 32% of A, 20% of B, and the remaining percentage of C. Determine its empirical formula.

(Given atomic masses: A = 64; B = 40; C = 32 u)

  • (A) \( ABC_4 \)
  • (B) \( A_2BC_2 \)
  • (C) \( ABC_3 \)
  • (D) \( AB_2C_2 \)
Correct Answer: (3) \( ABC_3 \)
View Solution

Question 96:

The plot of osmotic pressure (\(\Pi\)) vs concentration (mol L\(^{-1}\)) for a solution gives a straight line with slope 25.73 L bar mol\(^{-1}\). The temperature at which the osmotic pressure measurement is performed is:

(Use \( R = 0.083 \) L bar mol\(^{-1}\) K\(^{-1}\))

  • (A) \(12.05^\circ C \)
  • (B) \(37^\circ C \)
  • (C) \(310^\circ C \)
  • (D) \(25.73^\circ C \)
Correct Answer: (2) \(37^\circ C \)
View Solution

Question 97:

Identify the major product C formed in the following reaction sequence:

Reaction:
\[ CH_3 - CH_2 - CH_2 - I \xrightarrow{NaCN} A \xrightarrow{OH^- (Partial hydrolysis)} B \xrightarrow{NaOH, Br_2} C (major) \]

  • (A) \( \alpha \)-bromobutanoic acid
  • (B) propylamine
  • (C) butylamine
  • (D) butanamide
Correct Answer: (2) propylamine
View Solution

Question 98:

During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acids is added to prevent hydrolysis of \( Fe^{2+} \) ion?

  • (A) dilute sulphuric acid
  • (B) dilute hydrochloric acid
  • (C) concentrated sulphuric acid
  • (D) dilute nitric acid
Correct Answer: (1) dilute sulphuric acid
View Solution

Question 99:

The rate of a reaction quadruples when temperature changes from \( 27^\circ C \) to \( 57^\circ C \). Calculate the energy of activation.

(Given \( R = 8.314 \) J K\(^{-1}\) mol\(^{-1}\), \( \log 4 = 0.6021 \))

  • (A) \( 3804 \) kJ/mol
  • (B) \( 38.04 \) kJ/mol
  • (C) \( 380.4 \) kJ/mol
  • (D) \( 3.80 \) kJ/mol
Correct Answer: (2) 38.04 kJ/mol
View Solution

Question 100:

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given: Molar mass of Cu: 63 g mol\(^{-1}\), 1 F = 96487 C)

  • (A) \( 0.0315 \) g
  • (B) \( 3.15 \) g
  • (C) \( 0.315 \) g
  • (D) \( 31.5 \) g
Correct Answer: (3) \( 0.315 \) g
View Solution

Question 101:

The cofactor of the enzyme carboxypeptidase is:

  • (A) Haem
  • (B) Zinc
  • (C) Niacin
  • (D) Flavin
Correct Answer: (2) Zinc
View Solution

Question 102:

Given below are two statements:

Statement I: Parenchyma is living but collenchyma is dead tissue.

Statement II: Gymnosperms lack xylem vessels, but xylem vessels are characteristic of angiosperms.

Choose the correct answer from the options given below:

  • (A) Statement I is false but Statement II is true
  • (B) Both Statement I and Statement II are true
  • (C) Both Statement I and Statement II are false
  • (D) Statement I is true but Statement II is false
Correct Answer: (1) Statement I is false but Statement II is true
View Solution

Question 103:

Spindle fibers attach to kinetochores of chromosomes during:

  • (A) Telophase
  • (B) Prophase
  • (C) Metaphase
  • (D) Anaphase
Correct Answer: (3) \textbf{Metaphase}
View Solution

Question 104:

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

  • (A) BB/Bb
  • (B) BB
  • (C) bb
  • (D) Bb
Correct Answer: (3) bb
View Solution

Question 105:

The equation of Verhulst-Pearl logistic growth is: \[ \frac{dN}{dt} = rN \left[ \frac{K - N}{K} \right] \]
From this equation, \( K \) indicates:

  • (A) Population density
  • (B) Intrinsic rate of natural increase
  • (C) Biotic potential
  • (D) Carrying capacity
Correct Answer: (4) \textbf{Carrying capacity}
View Solution

Question 106:

How many molecules of ATP and NADPH are required for every molecule of \( CO_2 \) fixed in the Calvin cycle?

  • (A) 3 molecules of ATP and 2 molecules of NADPH
  • (B) 2 molecules of ATP and 3 molecules of NADPH
  • (C) 2 molecules of ATP and 2 molecules of NADPH
  • (D) 3 molecules of ATP and 3 molecules of NADPH
Correct Answer: (1) \textbf{3 molecules of ATP and 2 molecules of NADPH}
View Solution

Question 107:

Match List I with List II.

\begin{table[h]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I (Microorganism) & List II (Product)

\hline
A. \textit{Clostridium butylicum & I. Ethanol

B. \textit{Saccharomyces cerevisiae & II. Streptokinase

C. \textit{Trichoderma polysporum & III. Butyric acid

D. \textit{Streptococcus sp. & IV. Cyclosporin-A

\hline
\end{tabular
\end{table


(A) A-IV, B-I, C-II, D-III

(B) A-III, B-I, C-II, D-IV

(C) A-II, B-IV, C-III, D-I

(D) A-III, B-I, C-IV, D-II

Correct Answer: (4) \textbf{A-III, B-I, C-IV, D-II}
View Solution

Question 108:

These are regarded as major causes of biodiversity loss:


[A.] Over exploitation
[B.] Co-extinction
[C.] Mutation
[D.] Habitat loss and fragmentation
[E.] Migration


Choose the correct option:

  • (A) A, B and D only
  • (B) A, C and D only
  • (C) A, B, C and D only
  • (D) A, B and E only
Correct Answer: (1) \textbf{A, B and D only}
View Solution

Question 109:

Given below are two statements:

Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.

Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.

In the light of the above statements, choose the correct answer from the options given below:

  • (A) Statement I is false but Statement II is true
  • (B) Both Statement I and Statement II are true
  • (C) Both Statement I and Statement II are false
  • (D) Statement I is true but Statement II is false
Correct Answer: (2) \textbf{Both Statement I and Statement II are true}
View Solution

Question 110:

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

  • (A) can help in cell division in grasses, to produce growth.
  • (B) promotes apical dominance.
  • (C) promotes abscission of mature leaves only.
  • (D) does not affect mature monocotyledonous plants.
Correct Answer: (4) \textbf{does not affect mature monocotyledonous plants}
View Solution

Question 111:

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

  • (A) Red, Pink as well as white flowered plants
  • (B) Only red flowered plants
  • (C) Red flowered as well as pink flowered plants
  • (D) Only pink flowered plants
Correct Answer: (3) Red flowered as well as pink flowered plants
View Solution

Question 112:

Which of the following are required for the dark reaction of photosynthesis?


[A.] Light
[B.] Chlorophyll
[C.] CO\(_2\)
[D.] ATP
[E.] NADPH

  • (A) D and E only
  • (B) A, B and C only
  • (C) B, C and D only
  • (D) C, D and E only
Correct Answer: (4) C, D and E only
View Solution

Question 113:

The lactose present in the growth medium of bacteria is transported to the cell by the action of

  • (A) Polymerase
  • (B) Beta-galactosidase
  • (C) Acetylase
  • (D) Permease
Correct Answer: (4) Permease
View Solution

Question 114:

Identify the type of flowers based on the position of calyx, corolla, and androecium with respect to the ovary from the given figures (a) and (b):


  • (A) (a) Perigynous; (b) Perigynous
  • (B) (a) Epigynous; (b) Hypogynous
  • (C) (a) Hypogynous; (b) Epigynous
  • (D) (a) Perigynous; (b) Epigynous
Correct Answer: (1) (a) Perigynous; (b) Perigynous
View Solution

Question 115:

Match List I with List II

% Table
\begin{table[h!]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List-I & List-II

\hline
A. \textit{Rhizopus & I. Mushroom

B. \textit{Ustilago & II. Smut fungus

C. \textit{Puccinia & III. Bread mould

D. \textit{Agaricus & IV. Rust fungus

\hline
\end{tabular
\end{table

  • (A) A-IV, B-III, C-II, D-I
  • (B) A-III, B-II, C-IV, D-I
  • (C) A-I, B-III, C-II, D-IV
  • (D) A-III, B-II, C-I, D-IV
Correct Answer: (2) A-III, B-II, C-IV, D-I
View Solution

Question 116:

The type of conservation in which the threatened species are taken out from their natural habitat and placed in a special setting where they can be protected and given special care is called:

  • (A) Sustainable development
  • (B) in-situ conservation
  • (C) Biodiversity conservation
  • (D) Semi-conservative method
Correct Answer: (3) Biodiversity conservation
View Solution

Question 117:

Match List I with List II

% Creating a well-structured table
\begin{table[h!]
\centering
\renewcommand{\arraystretch{1.2 % Adjust row height
\begin{tabular{|c|l|c|l|
\hline
& List-I & & List-II

\hline
A & Nucleolus & I & Site of formation of glycolipid

B & Centriole & II & Organization like the cartwheel

C & Leucoplasts & III & Site for active ribosomal RNA synthesis

D & Golgi apparatus & IV & For storing nutrients

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-III, D-IV
  • (2) A-III, B-II, C-IV, D-I
  • (3) A-II, B-III, C-I, D-IV
  • (4) A-III, B-IV, C-II, D-I
Correct Answer: (2) A-III, B-II, C-IV, D-I
View Solution

Question 118:

The capacity to generate a whole plant from any cell of the plant is called:

  • (A) Somatic hybridization
  • (B) Totipotency
  • (C) Micropropagation
  • (D) Differentiation
Correct Answer: (2) Totipotency
View Solution

Question 119:

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

  • (A) Maturation
  • (B) Differentiation
  • (C) Redifferentiation
  • (D) Dedifferentiation
Correct Answer: (4) Dedifferentiation
View Solution

Question 120:

Which one of the following can be explained on the basis of Mendel's Law of Dominance?


Out of one pair of factors one is dominant and the other is recessive.
Alleles do not show any expression and both the characters appear as such in \( F_2 \) generation.
Factors occur in pairs in normal diploid plants.
The discrete unit controlling a particular character is called factor.
The expression of only one of the parental characters is found in a monohybrid cross.

  • (A) A, B, C, D and E
  • (B) A, B and C only
  • (C) A, C, D and E only
  • (D) B, C and D only
Correct Answer: (3) A, C, D and E only
View Solution

Question 121:

What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?


The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
It may get integrated into the genome of the recipient.
It may multiply and be inherited along with the host DNA.
The alien piece of DNA is not an integral part of the chromosome.
It shows ability to replicate.

  • (A) A and E only
  • (B) A and B only
  • (C) D and E only
  • (D) B and C only
Correct Answer: (4) B and C only
View Solution

Question 122:

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.


  • (A) D
  • (B) A
  • (C) B
  • (D) C
Correct Answer: (4) C
View Solution

Question 123:

Match List I with List II

\begin{table[h]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I & List II

\hline
A. Two or more alternative forms of a gene & I. Back cross

B. Cross of F1 progeny with homozygous recessive parent & II. Ploidy

C. Cross of F1 progeny with any of the parents & III. Allele

D. Number of chromosome sets in plant & IV. Test cross

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-II, D-I
  • (2) A-I, B-II, C-III, D-IV
  • (3) A-II, B-I, C-II, D-III
  • (4) A-III, B-IV, C-I, D-II
Correct Answer: (4) A-III, B-IV, C-I, D-II
View Solution

Question 124:

Identify the set of correct statements:


The flowers of \textit{Vallisneria are colourful and produce nectar.
The flowers of water lily are not pollinated by water.
In most of water-pollinated species, the pollen grains are protected from wetting.
Pollen grains of some hydrophytes are long and ribbon-like.
In some hydrophytes, the pollen grains are carried passively inside water.

  • (A) B, C, D and E only
  • (B) C, D and E only
  • (C) A, B, C and D only
  • (D) A, C, D and E only
Correct Answer: (1) B, C, D and E only
View Solution

Question 125:

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

  • (A) Enzyme activation
  • (B) Cofactor inhibition
  • (C) Feedback inhibition
  • (D) Competitive inhibition
Correct Answer: (4) Competitive inhibition
View Solution

Question 126:

List of endangered species was released by

  • (A) IUCN
  • (B) GEAC
  • (C) WWF
  • (D) FOAM
Correct Answer: (A) IUCN
View Solution

Question 127:

Given below are two statements:

Statement I: Bt toxins are insect group specific and coded by a gene \textit{cry IAc.

Statement II: Bt toxin exists as inactive protoxin in \textit{B. thuringiensis. However, after ingestion by the insect, the inactive protoxin gets converted into active form due to acidic pH of the insect gut.

In the light of the above statements, choose the correct answer from the options given below:

  • (A) Statement I is false but Statement II is true
  • (B) Both Statement I and Statement II are true
  • (C) Both Statement I and Statement II are false
  • (D) Statement I is true but Statement II is false
Correct Answer: (D) Statement I is true but Statement II is false
View Solution

Question 128:

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

  • (A) Carbohydrates
  • (B) Amino acids
  • (C) Phospholipids
  • (D) Glycerides
Correct Answer: (C) Phospholipids
View Solution

Question 129:

Which of the following is an example of actinomorphic flower?

  • (A) Sesbania
  • (B) Datura
  • (C) Cassia
  • (D) Pisum
Correct Answer: (B) \textit{Datura}
View Solution

Question 130:

Tropical regions show greatest level of species richness because

  • (A) Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.
  • (B) Tropical environments are more seasonal.
  • (C) More solar energy is available in tropics.
  • (D) Constant environments promote niche specialization.
  • (E) Tropical environments are constant and predictable.
    (A) A, B and D only
    (B) A, C, D and E only
    (C) A and B only
    (D) A, B and E only
Correct Answer: (B) A, C, D and E only
View Solution

Question 131:

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

  • (A) 10 bp
  • (B) 8 bp
  • (C) 6 bp
  • (D) 4 bp
Correct Answer: (C) 6 bp
View Solution

Question 132:

Bulliform cells are responsible for

  • (A) Providing large spaces for storage of sugars.
  • (B) Inward curling of leaves in monocots.
  • (C) Protecting the plant from salt stress.
  • (D) Increased photosynthesis in monocots.
Correct Answer: (B) Inward curling of leaves in monocots.
View Solution

Question 133:

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end:

  • (A) Promoter, Structural gene, Terminator
  • (B) Repressor, Operator gene, Structural gene
  • (C) Structural gene, Transposons, Operator gene
  • (D) Inducer, Repressor, Structural gene
Correct Answer: (A) Promoter, Structural gene, Terminator
View Solution

Question 134:

Which one of the following is not a criterion for classification of fungi?

  • (A) Fruiting body
  • (B) Morphology of mycelium
  • (C) Mode of nutrition
  • (D) Mode of spore formation
Correct Answer: (C) Mode of nutrition
View Solution

Question 135:

In the given figure, which component has thin outer walls and highly thickened inner walls?

  • (A) B
  • (B) C
  • (C) D
  • (D) A
Correct Answer: (B) C
View Solution

Question 136:

Match List I with List II


\begin{table[h]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I (Types of Stamens) & List II (Example)

\hline
A. Monadelphous & I. Citrus

B. Diadelphous & II. Pea

C. Polyadelphous & III. Lily

D. Epiphyllous & IV. China-rose

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-IV, D-II
  • (2) A-IV, B-II, C-I, D-III
  • (3) A-IV, B-I, C-II, D-III
  • (4) A-I, B-II, C-IV, D-III
Correct Answer: (2) A-IV, B-II, C-I, D-III
View Solution

Question 137:

The DNA present in chloroplast is:

  • (1) Circular, single stranded
  • (2) Linear, double stranded
  • (3) Circular, double stranded
  • (4) Linear, single stranded
Correct Answer: (3) Circular, double stranded
View Solution

Question 138:

Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

  • (A) Asexual reproduction occurs usually by biflagellate zoospores.
  • (B) Sexual reproduction is by oogamous method only.
  • (C) Stored food is in the form of carbohydrates which is either mannitol or laminarin.
  • (D) The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
  • (E) Vegetative cells have a cellulosic wall, usually covered on the outside by a gelatinous coating of algin.
    \textbf{Choose the correct answer from the options given below:}
  • (1) A, B, C and E only
  • (2) A, B, C and D only
  • (3) B, C, D and E only
  • (4) A, C, D and E only
Correct Answer: (4) A, C, D and E only
View Solution

Question 139:

Match List I with List II

\begin{table[h]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I & List II

\hline
A. Citric acid cycle & I. Cytoplasm

B. Glycolysis & II. Mitochondrial matrix

C. Electron transport system & III. Intermembrane space of mitochondria

D. Proton gradient & IV. Inner mitochondrial membrane

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-II, D-I
  • (2) A-II, B-I, C-III, D-IV
  • (3) A-I, B-II, C-III, D-IV
  • (4) A-III, B-IV, C-I, D-II
Correct Answer: (2) A-II, B-I, C-III, D-IV
View Solution

Question 140:

Given below are two statements:

Statement I: In \(C_3\) plants, some \(O_2\) binds to RuBisCO, hence \(CO_2\) fixation is decreased.

Statement II: In \(C_4\) plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

In the light of the above statements, Choose the correct answer from the options given below:

  • (1) Statement I is false but Statement II is true
  • (2) Both Statement I and Statement II are true
  • (3) Both Statement I and Statement II are false
  • (4) Statement I is true but Statement II is false
Correct Answer: (4) Statement I is true but Statement II is false
View Solution

Question 141:

Which of the following statement is correct regarding the process of replication in E. coli?

  • (1) The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' direction
  • (2) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3' \(\rightarrow\) 5'
  • (3) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' \(\rightarrow\) 3'
  • (4) The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' as well as 3' \(\rightarrow\) 5' direction
Correct Answer: (1) The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' direction
View Solution

Question 142:

Match List I with List II.

\begin{table[h]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I & List II

\hline
A. Robert May & I. Species-Area relationship

B. Alexander von Humboldt & II. Long-term ecosystem experiment using outdoor plots

C. Paul Ehrlich & III. Global species diversity at about 7 million

D. David Tilman & IV. Rivet popper hypothesis

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-II, D-I
  • (2) A-II, B-III, C-I, D-IV
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-I, B-III, C-II, D-IV
Correct Answer: (3) A-III, B-I, C-IV, D-II
View Solution

Question 143:

Match List I with List II.

\begin{table[h]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I & List II

\hline
A. Frederick Griffith & I. Genetic code

B. Francois Jacob \& Jacque Monod & II. Semi-conservative mode of DNA replication

C. Har Gobind Khorana & III. Transformation

D. Meselson \& Stahl & IV. Lac operon

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

  • (1) A-IV, B-I, C-II, D-III
  • (2) A-III, B-II, C-I, D-IV
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-II, B-III, C-IV, D-I
Correct Answer: (3) A-III, B-IV, C-I, D-II
View Solution

Question 144:

In an ecosystem, if the Net Primary Productivity (NPP) of the first trophic level is \(100x\) \(kcal m^{-2} yr^{-1}\), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

  • (1) \( \frac{100x}{3} \) \(kcal m^{-2} yr^{-1}\)
  • (2) \( \frac{x}{10} \) \(kcal m^{-2} yr^{-1}\)
  • (3) \( x \) \(kcal m^{-2} yr^{-1}\)
  • (4) \( 10x \) \(kcal m^{-2} yr^{-1}\)
Correct Answer: (4) \( 10x \) \(\text{kcal m}^{-2} \text{yr}^{-1}\)
View Solution

Question 145:

Match List I with List II.

\begin{table[h]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I & List II

\hline
A. Rose & I. Twisted aestivation

B. Pea & II. Perigynous flower

C. Cotton & III. Drupe

D. Mango & IV. Marginal placentation

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-IV, D-I
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-I, B-II, C-III, D-IV
  • (4) A-IV, B-III, C-II, D-I
Correct Answer: (2) A-II, B-IV, C-I, D-III
View Solution

Question 146:

Identify the correct description about the given figure:


  • (1) Compact inflorescence showing complete autogamy
  • (2) Wind pollinated plant inflorescence showing flowers with well-exposed stamens.
  • (3) Water pollinated flowers showing stamens with mucilaginous covering.
  • (4) Cleistogamous flowers showing autogamy.
Correct Answer: (2) Wind pollinated plant inflorescence showing flowers with well-exposed stamens.
View Solution

Question 147:

Identify the step in the tricarboxylic acid cycle, which does not involve oxidation of substrate.

  • (1) Isocitrate \(\rightarrow\) \(\alpha\)-ketoglutaric acid
  • (2) Malic acid \(\rightarrow\) Oxaloacetic acid
  • (3) Succinic acid \(\rightarrow\) Malic acid
  • (4) Succinyl-CoA \(\rightarrow\) Succinic acid
Correct Answer: (4) Succinyl-CoA \(\rightarrow\) Succinic acid
View Solution

Question 148:

Spraying sugarcane crop with which of the following plant growth regulators increases the length of the stem, thus, increasing the yield?

  • (1) Abscisic acid
  • (2) Auxin
  • (3) Gibberellin
  • (4) Cytokinin
Correct Answer: (3) Gibberellin
View Solution

Question 149:

Match List-I with List-II



\begin{array{|l|l|
\hline
List-I & List-II

\hline
\text{A. GLUT-4 & \text{I. Hormone

\text{B. Insulin & \text{II. Enzyme

\text{C. Trypsin & \text{III. ntercellular ground substance

\text{D. Collagen & \text{IV. Enables glucose transport into cells

\hline
\end{array



Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-I, D-II
  • (2) A-IV, B-I, C-II, D-III
  • (3) A-I, B-II, C-III, D-IV
  • (4) A-II, B-III, C-IV, D-I
Correct Answer: (2) A-IV, B-I, C-II, D-III
View Solution

Question 150:

Which of the following are fused in somatic hybridization involving two varieties of plants?

  • (1) Pollens
  • (2) Callus
  • (3) Somatic embryos
  • (4) Protoplasts
Correct Answer: (4) Protoplasts
View Solution

Question 151:

The flippers of the Penguins and Dolphins are an example of the:

  • (1) Divergent evolution
  • (2) Adaptive radiation
  • (3) Natural selection
  • (4) Convergent evolution
Correct Answer: (4) Convergent evolution
View Solution

Question 152:

Match List I with List II and choose the correct answer from the options given below:

\begin{table[h]
\centering
\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I & List II

\hline
A. Pleurobrachia & I. Mollusca

B. Radula & II. Ctenophora

C. Stomochord & III. Osteichthyes

D. Air bladder & IV. Hemichordata

\hline
\end{tabular
\end{table

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-II, D-I
  • (2) A-IV, B-II, C-III, D-I
  • (3) A-II, B-I, C-IV, D-III
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (3) A-II, B-I, C-IV, D-III
View Solution

Question 153:

Which of the following is not a component of the Fallopian tube?

  • (1) Ampulla
  • (2) Uterine fundus
  • (3) Isthmus
  • (4) Infundibulum
Correct Answer: (2) Uterine fundus
View Solution

Question 154:

Following are the stages of the pathway for conduction of an action potential through the heart:


\begin{tabular{ c l
A. & AV bundle

B. & Purkinje fibres

C. & AV node

D. & Bundle branches

E. & SA node

\end{tabular


Choose the correct sequence of the pathway from the options given below:

  • (1) E-A-D-B-C
  • (2) E-C-A-D-B
  • (3) A-E-C-B-D
  • (4) B-D-E-C-A
Correct Answer: (2) E-C-A-D-B
View Solution

Question 155:

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Statement I is false but Statement II is true
  • (2) Both Statement I and Statement II are true
  • (3) Both Statement I and Statement II are false
  • (4) Statement I is true but Statement II is false
Correct Answer: (4) Statement I is true but Statement II is false
View Solution

Question 156:

Match List I with List II:



\begin{array{|l|l|
\hline
List I & List II

\hline
\text{A. \( \alpha \)-1 antitrypsin & \text{I. Cotton bollworm

\text{B. Cry IAb & \text{II. ADA deficiency

\text{C. Cry IAc & \text{III. Emphysema

\text{D. Enzyme replacement therapy & \text{IV. Corn borer

\hline
\end{array



Choose the correct answer from the options given below:

  • (1) A-II, B-IV, C-I, D-III
  • (2) A-II, B-I, C-IV, D-III
  • (3) A-III, B-I, C-II, D-IV
  • (4) A-III, B-IV, C-I, D-II
Correct Answer: (4) A-III, B-IV, C-I, D-II
View Solution

Question 157:

Given below are two statements: one is labeled as Assertion (A) and the other as Reason (R):

Assertion A: FSH acts upon ovarian follicles in females and Leydig cells in males.

Reason R: Growing ovarian follicles secrete estrogen in females, while interstitial cells secrete androgen in male human beings.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) A is false but R is true
  • (2) Both A and R are true and R is the correct explanation of A
  • (3) Both A and R are true but R is NOT the correct explanation of A
  • (4) A is true but R is false
Correct Answer: (1) A is false but R is true
View Solution

Question 158:

Match List I with List II:



\begin{array{|c|l|l|
\hline
List I & List II

\hline
\text{A. Cocaine & \text{I. \textit{Effective sedative in surgery

\text{B. Heroin & \text{II. \textit{Cannabis sativa

\text{C. Morphine & \text{III. Erythroxylum

\text{D. Marijuana & \text{IV. \textit{Papaver somniferum

\hline
\end{array


Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-I, D-II
  • (2) A-IV, B-III, C-I, D-II
  • (3) A-I, B-III, C-II, D-IV
  • (4) A-II, B-I, C-III, D-IV
Correct Answer: (1) A-III, B-IV, C-I, D-II
View Solution

Question 159:

Match List I with List II:


\begin{array{|l|l|
\hline
List I & List II

\hline
\text{A. Lipase & \text{I. Peptide bond

\text{B. Nuclease & \text{II. Ester bond

\text{C. Protease & \text{III. Glycosidic bond

\text{D. Amylase & \text{IV. Phosphodiester bond

\hline
\end{array



Choose the correct answer from the options given below :

  • (1) A-IV, B-I, C-III, D-II
  • (2) A-IV, B-II, C-III, D-I
  • (3) A-III, B-II, C-I, D-IV
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (4) A-II, B-IV, C-I, D-III
View Solution

Question 160:

Three types of muscles are given as (a), (b), and (c). Identify the correct matching pair along with their location in the human body:






Name of muscle/location:

  • (1) (a) Involuntary – Nose tip
    \hspace{0.5cm} (b) Skeletal – Bone
    \hspace{0.5cm} (c) Cardiac – Heart
  • (2) (a) Smooth – Toes
    \hspace{0.5cm} (b) Skeletal – Legs
    \hspace{0.5cm} (c) Cardiac – Heart
  • (3) (a) Skeletal – Triceps
    \hspace{0.5cm} (b) Smooth – Stomach
    \hspace{0.5cm} (c) Smooth – Heart
  • (4) (a) Skeletal – Biceps
    \hspace{0.5cm} (b) Involuntary – Intestine
    \hspace{0.5cm} (c) Cardiac – Heart
Correct Answer: (3) (a) Skeletal – Triceps, (b) Smooth – Stomach, (c) Smooth – Heart
View Solution

Question 161:

Match List I with List II:


\begin{array{|l|l|
\hline
List I & List II

\hline
\text{A. \textit{Pterophyllum & \text{I. Hag fish

\text{B. \textit{Myxine & \text{II. Saw fish

\text{C. \textit{Pristis & \text{III. Angel fish

\text{D. \textit{Exocoetus & \text{IV. Flying fish

\hline
\end{array


Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-I, D-IV
  • (2) A-II, B-I, C-III, D-IV
  • (3) A-III, B-I, C-II, D-IV
  • (4) A-IV, B-I, C-II, D-III
Correct Answer: (3) A-III, B-I, C-II, D-IV
View Solution

Question 162:

Match List I with List II :
\[ \begin{array}{|l|l|} \hline \textbf{List I} & \textbf{List II}
\hline A. Fibrous joints & I.Adjacent vertebrae, limited movement
B. Cartilaginous joints & II.Humerus and Pectoral girdle, rotational movement
C. Hinge joints & III.kull, don’t allow any movement
D. Ball and socket joints & IV. Knee, help in locomotion
\hline \end{array} \]


Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-IV, D-II
  • (2) A-IV, B-II, C-III, D-I
  • (3) A-I, B-III, C-II, D-IV
  • (4) A-II, B-III, C-I, D-IV
Correct Answer: (1) A-III, B-I, C-IV, D-II
View Solution

Question 163:

Following are the stages of cell division:


\begin{tabular{ c l
A. & Gap 2 (G\(_2\)) phase

B. & Cytokinesis

C. & Synthesis (S) phase

D. & Karyokinesis

E. & Gap 1 (G\(_1\)) phase

\end{tabular


Choose the correct sequence of stages from the options given below:

  • (1) E-C-A-D-B
  • (2) C-E-D-A-B
  • (3) E-B-D-A-C
  • (4) B-D-E-A-C
Correct Answer: (1) E-C-A-D-B
View Solution

Question 164:

The “Ti plasmid” of Agrobacterium tumefaciens stands for:

  • (1) Temperature independent plasmid
  • (2) Tumour inhibiting plasmid
  • (3) Tumor independent plasmid
  • (4) Tumor inducing plasmid
Correct Answer: (4) Tumor inducing plasmid
View Solution

Question 165:

Match List I with List II: \[ \begin{array}{|l|l|} \hline \textbf{List I} & \textbf{List II}
\hline A. Pons & I. Provides additional space for Neurons, regulates posture and balance.
B. Hypothalamus & II. Controls respiration and gastric secretions.
C. Medulla & III. Connects different regions of the brain.
D. Cerebellum & IV. Neuro secretory cells.
\hline \end{array} \]


Choose the correct answer from the options given below

  • (1) A-II, B-I, C-III, D-IV
  • (2) A-II, B-III, C-I, D-IV
  • (3) A-III, B-IV, C-II, D-I
  • (4) A-I, B-III, C-II, D-IV
Correct Answer: (3) A-III, B-IV, C-II, D-I
View Solution

Question 166:

Match List I with List II:
\[ \begin{array}{|l|l|} \hline \textbf{List I} & \textbf{List II}
\hline A. Axoneme & I. Centriole
B. Cartwheel pattern & II. Cilia and flagella
C. Crista & III. Chromosome
D. Satellite & IV. Mitochondria
\hline \end{array} \]


Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-IV, D-III
  • (2) A-IV, B-III, C-II, D-I
  • (3) A-IV, B-II, C-III, D-I
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (1) A-II, B-I, C-IV, D-III
View Solution

Question 167:

Consider the following statements:

\begin{tabular{ c l
A. & Annelids are true coelomates

B. & Poriferans are pseudocoelomates

C. & Aschelminthes are acoelomates

D. & Platyhelminthes are pseudocoelomates

\end{tabular

Choose the correct answer from the options given below:

  • (1) D only
  • (2) B only
  • (3) A only
  • (4) C only
Correct Answer: (3) A only
View Solution

Question 168:

Which of the following is not a steroid hormone?

  • (1) Glucagon
  • (2) Cortisol
  • (3) Testosterone
  • (4) Progesterone
Correct Answer: (1) Glucagon
View Solution

Question 169:

Given below are two statements:

Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Statement I is false but Statement II is true
  • (2) Both Statement I and Statement II are true
  • (3) Both Statement I and Statement II are false
  • (4) Statement I is true but Statement II is false
Correct Answer: (3) Both Statement I and Statement II are false
View Solution

Question 170:

Match List I with List II:\


\begin{array{|l|l|
\hline
List I & List II

\hline
\text{A. Common cold & \text{I. \textit{Plasmodium

\text{B. Haemozoin & \text{II. Typhoid

\text{C. Widal test & \text{III. Rhinoviruses

\text{D. Allergy & \text{IV. Dust mites

\hline
\end{array


Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-II, B-IV, C-III, D-I
  • (3) A-I, B-III, C-II, D-IV
  • (4) A-III, B-I, C-II, D-IV
Correct Answer: (4) A-III, B-I, C-II, D-IV
View Solution

Question 171:

Match List I with List II and choose the correct answer from the options given below:



  • (1) A-I, B-III, C-II, D-IV
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-III, B-II, C-IV, D-I
  • (4) A-II, B-I, C-IV, D-III
Correct Answer: (2) A-II, B-IV, C-I, D-III
View Solution

Question 172:

Match List I (Sub Phases of Prophase I) with List II (Specific Characters) and choose the correct answer from the options given below:
\[ \begin{array}{|l|l|} \hline \textbf{List I (Sub Phases of Prophase I)} & \textbf{List II (Specific Characters)}
\hline A. Diakinesis & I. Synaptonemal complex formation
B. Pachytene & II. Completion of terminalisation of chiasmata
C. Zygotene & III. Chromosomes look like thin threads
D. Leptotene & IV. Appearance of recombination nodules
\hline \end{array} \]




\begin{array{ll
(1) & A-IV, B-III, C-II, D-I

(2) & A-IV, B-II, C-III, D-I

(3) & A-I, B-II, C-IV, D-III

(4) & A-II, B-IV, C-I, D-III

\end{array

Correct Answer: (4) A-II, B-IV, C-I, D-III
View Solution

Question 173:

Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R):

Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) A is not correct but R is correct
  • (2) Both A and R are correct and R is the correct explanation of A
  • (3) Both A and R are correct but R is NOT the correct explanation of A
  • (4) A is correct but R is not correct
Correct Answer: (2) Both A and R are correct and R is the correct explanation of A
View Solution

Question 174:

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

  • (1) Constant gene pool
  • (2) Genetic recombination
  • (3) Genetic drift
  • (4) Gene migration
Correct Answer: (1) Constant gene pool
View Solution

Question 175:

Match List I with List II:



\begin{array{|l|l|
\hline
List I & List II

\hline
\text{A. Typhoid & \text{I. Fungus

\text{B. Leishmaniasis & \text{II. Nematode

\text{C. Ringworm & \text{III. Protozoa

\text{D. Filariasis & \text{IV. Bacteria

\hline
\end{array

  • (1) & A-II, B-IV, C-III, D-I
  • (2) & A-I, B-III, C-II, D-IV
  • (3) & A-IV, B-III, C-I, D-II
  • (4) & A-III, B-I, C-IV, D-II
    \textbf{Choose the correct answer from the options given below:}
Correct Answer: (3) A-IV, B-III, C-I, D-II
View Solution

Question 176:

Given below are some stages of human evolution.

Arrange them in the correct sequence (Past to Recent):


\begin{tabular{ c l
A. & \textit{Homo habilis

B. & \textit{Homo sapiens

C. & \textit{Homo neanderthalensis

D. & \textit{Homo erectus

\end{tabular


Choose the correct sequence of human evolution from the options given below:

  • (1) A-D-C-B
  • (2) D-A-C-B
  • (3) B-A-D-C
  • (4) C-B-D-A
Correct Answer: (1) A-D-C-B
View Solution

Question 177:

The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:


  • (1) Gene ‘X’ is responsible for recognition sites and ‘Y’ is responsible for antibiotic resistance.
  • (2) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of plasmid.
  • (3) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of plasmid.
  • (4) The gene ‘X’ is for protein involved in replication of plasmid and ‘Y’ for resistance to antibiotics.
Correct Answer: (3) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of plasmid.
View Solution

Question 178:

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

  • (1) Low pCO\(_2\) and High temperature
  • (2) High pO\(_2\) and High pCO\(_2\)
  • (3) High pO\(_2\) and Lesser H\(^+\) concentration
  • (4) Low pCO\(_2\) and High H\(^+\) concentration
Correct Answer: (3) High pO\(_2\) and Lesser H\(^+\) concentration
View Solution

Question 179:

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

  • (1) 11th segment
  • (2) 5th segment
  • (3) 10th segment
  • (4) 8th and 9th segment
Correct Answer: (3) 10th segment
View Solution

Question 180:

Match List I with List II:


\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|
\hline
List I (Genetic Disorders) & List II(Chromosomal Association)

\hline
A. Down’s syndrome & I. 11st chromosome

B. \(\alpha\)-Thalassemia & II. ‘X’th chromosome

C. \(\beta\)-Thalassemia & III. 21th chromosome

D. Klinefelter’s syndrome & IV. 16 chromosome

\hline
\end{tabular


Choose the correct answer from the options given below:

  • (1) A-IV, B-I, C-II, D-III
  • (2) A-I, B-II, C-III, D-IV
  • (3) A-II, B-III, C-IV, D-I
  • (4) A-III, B-IV, C-I, D-II
Correct Answer: (4) A-III, B-IV, C-I, D-II
View Solution

Question 181:

Which of the following is not a natural/traditional contraceptive method?

  • (1) Vaults
  • (2) Coitus interruptus
  • (3) Periodic abstinence
  • (4) Lactational amenorrhea
Correct Answer: (1) Vaults
View Solution

Question 182:

Which of the following are Autoimmune disorders?

\begin{tabular{ l l
A. & Myasthenia gravis

B. & Rheumatoid arthritis

C. & Gout

D. & Muscular dystrophy

E. & Systemic Lupus Erythematosus (SLE)

\end{tabular

Choose the most appropriate answer from the options given below:

  • (1) C, D \& E only
  • (2) A, B \& D only
  • (3) A, B \& E only
  • (4) B, C \& E only
Correct Answer: (3) A, B \& E only
View Solution

Question 183:

Which of the following statements is incorrect?

  • (1) Bio-reactors have an agitator system, an oxygen delivery system and foam control system.
  • (2) A bio-reactor provides optimal growth conditions for achieving the desired product.
  • (3) Most commonly used bio-reactors are of stirring type.
  • (4) Bio-reactors are used to produce small scale bacterial cultures.
Correct Answer: (4) Bio-reactors are used to produce small scale bacterial cultures.
View Solution

Question 184:

Match List I with List II:


\renewcommand{\arraystretch{1.3
\begin{tabular{|l|l|l|l|
\hline
List I & Intrauterine Devices (IUDs) and Implants & List II & Examples

\hline
A. & Non-medicated IUD & I. & Multiload 375

B. & Copper releasing IUD & II. & Progestogens

C. & Hormone releasing IUD & III. & Lippes loop

D. & Implants & IV. & LNG-20

\hline
\end{tabular


Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-IV, D-II
  • (2) A-III, B-I, C-II, D-IV
  • (3) A-I, B-III, C-IV, D-II
  • (4) A-IV, B-I, C-II, D-III
Correct Answer: (1) A-III, B-I, C-IV, D-II
View Solution

Question 185:

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3' TACATGGCAAATATCCATTCA 5'

  • (1) \(5' ATGTACCGTTTAAGGTAAGT3'\)
  • (2) \(5' AUGUACCGUUUAUAGGUAAGU3'\)
  • (3) \(5' AUGUAAAGUUUAUAGGUAAGU3'\)
  • (4) \(5' AUGUACCGUUUAUAGGGAAGU3'\)
Correct Answer: (2) \(5' \text{AUGUACCGUUUAUAGGUAAGU3'}\)
View Solution

Question 186:

Given below are two statements:

Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons, and cerebrum.


In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Statement I is incorrect but Statement II is correct.
  • (2) Both Statement I and Statement II are correct.
  • (3) Both Statement I and Statement II are incorrect.
  • (4) Statement I is correct but Statement II is incorrect.
Correct Answer: (4) Statement I is correct but Statement II is incorrect.
View Solution

Question 187:

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior species will be eliminated if resources are limited.


In the light of the above statements, choose the correct answer from the options given below:

  • (1) Statement I is false but Statement II is true.
  • (2) Both Statement I and Statement II are true.
  • (3) Both Statement I and Statement II are false.
  • (4) Statement I is true but Statement II is false.
Correct Answer: (1) Statement I is false but Statement II is true.
View Solution

Question 188:

Identify the correct Option (A), (B), (C), and (D) with respect to spermatogenesis.


  • (1) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
  • (2) FSH, Leydig cells, Sertoli cells, spermiogenesis.
  • (3) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
  • (4) FSH, Sertoli cells, Leydig cells, spermatogenesis.
Correct Answer: (2) FSH, Leydig cells, Sertoli cells, spermiogenesis.
View Solution

Question 189:

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.


Choose the most appropriate answer from the options given below:

  • (1) B, C \& D only
  • (2) A \& C only
  • (3) A, B \& D only
  • (4) B, D \& E only
Correct Answer: (4) B, D \& E only.
View Solution

Question 190:

Match List I with List II:


\renewcommand{\arraystretch{1.3
\begin{tabular{|c|l|c|l|
\hline
List I & Epithelial Type & List II & Associated Organ

\hline
A. & Unicellular glandular epithelium & I. & Salivary glands

B. & Compound epithelium & II. & Pancreas

C. & Multicellular glandular epithelium & III. & Goblet cells of alimentary canal

D. & Endocrine glandular epithelium & IV. & Moist surface of buccal cavity

\hline
\end{tabular


Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-IV, D-III
  • (2) A-I, B-III, C-III, D-IV
  • (3) A-IV, B-III, C-I, D-II
  • (4) A-III, B-IV, C-I, D-II
Correct Answer: (4) A-III, B-IV, C-I, D-II
View Solution

Question 191:

Match List I with List II:





Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-I, D-III
  • (2) A-I, B-III, C-IV, D-II
  • (3) A-III, B-II, C-IV, D-I
  • (4) A-II, B-III, C-I, D-IV
Correct Answer: (3) A-III, B-II, C-IV, D-I \newpage
View Solution

Question 192:

Match List I with List II:





Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-I, D-II
  • (2) A-I, B-III, C-II, D-IV
  • (3) A-IV, B-II, C-I, D-III
  • (4) A-III, B-IV, C-II, D-I
Correct Answer: (1) A-III, B-IV, C-I, D-II
View Solution

Question 193:

Match List I with List II:
\[ \begin{array}{|l|l|} \hline \textbf{List I} & \textbf{List II}
\hline A. Mesozoic Era & I. Lower invertebrates
B. Proterozoic Era & II. Fish \& Amphibia
C. Cenozoic Era & III. Birds \& Reptiles
D. Paleozoic Era & IV. Mammals
\hline \end{array} \]

Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-IV, D-II
  • (2) A-II, B-I, C-III, D-IV
  • (3) A-III, B-I, C-IV, D-IV
  • (4) A-I, B-II, C-IV, D-III
Correct Answer: (1) A-III, B-I, C-IV, D-II
View Solution

Question 194:

Match List I with List II related to the digestive system of cockroach:



\resizebox{\textwidth{!{%
\begin{tabular{|>{\raggedright\arraybackslashp{8cm|>{\raggedright\arraybackslashp{8cm|
\hline
List I & List II

\hline
A. The structures used for storing of food & I. Gizzard

\hline
B. Ring of 6-8 blind tubules at junction of foregut and midgut. & II. Gastric Caeca

\hline
C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut. & III. Malpighian tubules

\hline
D. The structures used for grinding the food. & IV. Crop

\hline
\end{tabular%






Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-IV, D-I
  • (2) A-IV, B-II, C-III, D-I
  • (3) A-I, B-II, C-III, D-IV
  • (4) A-IV, B-III, C-II, D-I
Correct Answer: (2) A-IV, B-II, C-III, D-I
View Solution

Question 195:

Given below are two statements:

Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.


In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Statement I is incorrect but Statement II is correct.
  • (2) Both Statement I and Statement II are correct.
  • (3) Both Statement I and Statement II are incorrect.
  • (4) Statement I is correct but Statement II is incorrect.
Correct Answer: (2) Both Statement I and Statement II are correct.
View Solution

Question 196:

Match List I with List II:



\renewcommand{\arraystretch{1.3
\begin{tabular{|c|l|c|l|
\hline
List I & Description & List II & Description

\hline
A. & RNA polymerase III & I. & snRNPs

B. & Termination of transcription & II. & Promoter

C. & Splicing of Exons & III. & Rho factor

D. & TATA box & IV. & SnRNAs, tRNA

\hline
\end{tabular




Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-I, D-II
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-III, B-II, C-IV, D-I
  • (4) A-III, B-IV, C-I, D-II
Correct Answer: (1) A-IV, B-III, C-I, D-II
View Solution

Question 197:

Choose the correct statement given below regarding juxta medullary nephron.

  • (1) Juxta medullary nephrons outnumber the cortical nephrons.
  • (2) Juxta medullary nephrons are located in the columns of Bertini.
  • (3) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
  • (4) Loop of Henle of juxta medullary nephron runs deep into medulla.
Correct Answer: (4) Loop of Henle of juxta medullary nephron runs deep into medulla.
View Solution

Question 198:

Given below are two statements:

Statement I: Mitochondria and chloroplasts both double membranes bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.


In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Statement I is incorrect but Statement II is correct.
  • (2) Both Statement I and Statement II are correct.
  • (3) Both Statement I and Statement II are incorrect.
  • (4) Statement I is correct but Statement II is incorrect.
Correct Answer: (4) Statement I is correct but Statement II is incorrect.
View Solution

Question 199:

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:


A. Substrate enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.


Choose the correct answer from the options given below:

  • (1) E, D, C, B, A
  • (2) E, A, D, C, B
  • (3) A, E, B, D, C
  • (4) B, A, C, D, E
Correct Answer: (2) E, A, D, C, B
View Solution

Question 200:

As per ABO blood grouping system, the blood group of father is B\(^+\), mother is A\(^+\) and child is O\(^+\). Their respective genotype can be:


A. \( I^B I^A / ii \)

B. \( I^B I^B / I^A ii \)

C. \( I^A I^B / I^A I^B \)

D. \( I^A i / I^B I^A \)

E. \( ii I^B / I^A I^B \)


Choose the most appropriate answer from the options given below:

  • (1) D \& E only
  • (2) A only
  • (3) B only
  • (4) C \& B only
Correct Answer: (2) A only
View Solution

NEET Previous Year Question Papers with Answer Keys

Other UG Entrance Exams