NEET 2024 Zoology Question Paper with Solutions PDF Q1 is available for download. NEET 2024 Q1 Zoology Question Paper comprises 50 MCQs out of which only 45 are to be attempted. NEET 2024 question Q1 Zoology is divided into 2 sections- A (35 questions) and B (15 questions). You can download NEET 2024 zoology question paper with answer key and solutions PDF for Q1 using the links given below.
NEET 2024 Zoology Question Paper with Solutions PDF Q1
| NEET 2024 Q1 Question Paper with Answer Key | Download PDF | Check Solution |
Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:
Name of muscle/location
Following are the stages of the pathway for conduction of an action potential through the heart:
A. AV bundle \quad B. Purkinje fibres \quad C. AV node \quad D. Bundle branches \quad E. SA node
Choose the correct sequence of the pathway from the options given below:
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
Which of the following statements is incorrect?
Which one is the correct product of DNA-dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
Match List I with List II

Choose the correct answer from the options given below:
Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout
D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.
Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the options given below:
Match List I with List
II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Following are the stages of cell division:
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below:
Match List I with List II
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
The flippers of the Penguins and Dolphins are the example of:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.
Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.
In the light of the above statements, choose the most appropriate answer from the options given below:
Which of the following is not a component of the Fallopian tube?
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)
A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus
Choose the correct sequence of human evolution from the options given below:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
In the light of the above statements, choose the correct answer from the options given below:
Which of the following is not a steroid hormone?
Consider the following statements:
A. Annelids are true coelomates.
B. Poriferans are pseudocoelomates.
C. Aschelminthes are acoelomates.
D. Platyhelminthes are pseudocoelomates.
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:
Match List I with List II:
Choose the correct answer from the options given below:
The “Ti plasmid” of Agrobacterium tumefaciens stands for:
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: The presence or absence of hymen is not a reliable indicator of virginity.
Reason R: The hymen is torn during the first coitus only.
In the light of the above statements, choose the correct answer from the options given below:
The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:
Which of the following is not a natural/traditional contraceptive method?
Match List I with List II:
Choose the correct answer from the options given below:
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
Given below are two statements:
Statement I: Mitochondria and chloroplasts both are double-membrane bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.
In the light of the above statements, choose the most appropriate answer from the options given below:
Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.
In the light of the above statements, choose the correct answer from the options given below:
Regarding catalytic cycle of an enzyme action, select the correct sequential steps:
A. Substrate-enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
Match List I with List II related to digestive system of cockroach:
Choose the correct answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Given below are two statements:
Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.
Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.
In the light of the above statements, choose the most appropriate answer from the options given below:
Match List I with List II:
Choose the correct answer from the options given below:
Choose the correct statement given below regarding juxta medullary nephron:
As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:
The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post anal tail is absent.
Choose the most appropriate answer from the options given below:
NEET Previous Year Question Papers with Answer Keys
| NEET 2023 Question Papers | NEET 2022 Question Papers | NEET 2021 Question Papers |
| NEET 2020 Question Papers | NEET 2019 Question Papers | NEET 2018 Question Papers |







Comments