NEET 2024 Zoology Question Paper with Answers and Solutions PDF Q1

Associate Content Manager | Updated 3+ months ago

NEET 2024 Zoology Question Paper with Solutions PDF Q1 is available for download. NEET 2024 Q1 Zoology Question Paper comprises 50 MCQs out of which only 45 are to be attempted. NEET 2024 question Q1 Zoology is divided into 2 sections- A (35 questions) and B (15 questions). You can download NEET 2024 zoology question paper with answer key and solutions PDF for Q1 using the links given below.

NEET 2024 Zoology Question Paper with Solutions PDF Q1

NEET 2024 Q1 Question Paper with Answer Key	Download PDF	Check Solution

Question 151:

Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:

Name of muscle/location

(1) (a) Skeletal - Triceps
(b) Smooth – Stomach
(c) Cardiac – Heart
(2) (a) Skeletal - Biceps
(b) Involuntary – Intestine
(c) Smooth – Heart
(3) (a) Involuntary – Nose tip
(b) Skeletal – Bone
(c) Cardiac – Heart
(4) (a) Smooth - Toes
(b) Skeletal – Legs
(c) Cardiac – Heart

Correct Answer:(1) (a) Skeletal - Triceps
(b) Smooth – Stomach
(c) Cardiac – Heart

Question 152:

Following are the stages of the pathway for conduction of an action potential through the heart:
A. AV bundle \quad B. Purkinje fibres \quad C. AV node \quad D. Bundle branches \quad E. SA node
Choose the correct sequence of the pathway from the options given below:

(1) A-E-C-B-D
(2) B-D-E-C-A
(3) E-A-D-B-C
(4) E-C-A-D-B

Correct Answer: (4) E-C-A-D-B

Question 153:

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

(1) Genetic drift
(2) Gene migration
(3) Constant gene pool
(4) Genetic recombination

Correct Answer: (3) Constant gene pool

Question 154:

Which of the following statements is incorrect?

(1) Most commonly used bio-reactors are of stirring type
(2) Bio-reactors are used to produce small-scale bacterial cultures
(3) Bio-reactors have an agitator system, an oxygen delivery system, and foam control system
(4) A bio-reactor provides optimal growth conditions for achieving the desired product

Correct Answer: (2) Bio-reactors are used to produce small-scale bacterial cultures

Question 155:

Which one is the correct product of DNA-dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’

(1) 5’AUGUAAAGUUUAUAGGUAAGU3’
(2) 5’AUGUACCGUUUAUAGGGAAGU3’
(3) 5’ATGTACCGTTTATAGGTAAGT3’
(4) 5’AUGUACCGUUUAUAGGUAAGU3’

Correct Answer: (4) 5’AUGUACCGUUUAUAGGUAAGU3’

Question 156:

Match List I with List II

Choose the correct answer from the options given below:

(1) A-III, B-I, C-II, D-IV
(2) A-III, B-IV, C-I, D-II
(3) A-II, B-IV, C-I, D-III
(4) A-II, B-I, C-IV, D-III

Correct Answer: (2) A-III, B-IV, C-I, D-II

Question 157:

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

(1) A, B & E only
(2) B, C & E only
(3) C, D & E only
(4) A, B & D only

Correct Answer: (1) A, B & E only

Question 158:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-II, B-III, C-IV, D-I
(2) A-III, B-IV, C-I, D-II
(3) A-IV, B-I, C-II, D-III
(4) A-I, B-II, C-III, D-IV

Correct Answer: (2) A-III, B-IV, C-I, D-II

Question 159:

Given below are two statements:

Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are false
(2) Statement I is true but Statement II is false
(3) Statement I is false but Statement II is true
(4) Both Statement I and Statement II are true

Correct Answer: (1) Both Statement I and Statement II are false

Question 160:

Match List I with List
II:

Choose the correct answer from the options given below:

(1) A-III, B-IV, C-II, D-I
(2) A-I, B-III, C-II, D-IV
(3) A-II, B-I, C-III, D-IV
(4) A-II, B-III, C-I, D-IV

Correct Answer: (1) A-III, B-IV, C-II, D-I

Question 161:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-III, D-I
(2) A-II, B-IV, C-I, D-III
(3) A-II, B-I, C-IV, D-III
(4) A-IV, B-III, C-II, D-I

Correct Answer: (3) A-II, B-I, C-IV, D-III

Question 162:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-I, B-III, C-II, D-IV
(2) A-II, B-III, C-I, D-IV
(3) A-III, B-I, C-IV, D-II
(4) A-IV, B-II, C-III, D-I

Correct Answer: (3) A-III, B-I, C-IV, D-II

Question 163:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-III, B-I, C-II, D-IV
(2) A-IV, B-I, C-II, D-III
(3) A-III, B-II, C-I, D-IV
(4) A-II, B-I, C-III, D-IV

Correct Answer: (1) A-III, B-I, C-II, D-IV

Question 164:

Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase
Choose the correct sequence of stages from the options given below:

(1) E-B-D-A-C
(2) B-D-E-A-C
(3) E-C-A-D-B
(4) C-E-D-A-B

Correct Answer: (3) E-C-A-D-B

Question 165:

Match List I with List II

Choose the correct answer from the options given below:

(1) A-I, B-III, C-IV, D-II
(2) A-IV, B-I, C-II, D-III
(3) A-III, B-I, C-IV, D-II
(4) A-III, B-I, C-II, D-IV

Correct Answer: (3) A-III, B-I, C-IV, D-II

Question 166:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-III, B-II, C-I, D-IV
(2) A-II, B-IV, C-I, D-III
(3) A-IV, B-I, C-III, D-II
(4) A-IV, B-II, C-III, D-I

Correct Answer: (2) A-II, B-IV, C-I, D-III

Question 167:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-III, B-II, C-IV, D-I
(2) A-II, B-I, C-IV, D-III
(3) A-I, B-III, C-II, D-IV
(4) A-II, B-IV, C-I, D-III

Correct Answer: (4) A-II, B-IV, C-I, D-III

Question 168:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-I, B-III, C-II, D-IV
(2) A-II, B-I, C-III, D-IV
(3) A-III, B-IV, C-I, D-II
(4) A-IV, B-III, C-I, D-II

Correct Answer: (3) A-III, B-IV, C-I, D-II

Question 169:

The flippers of the Penguins and Dolphins are the example of:

(1) Natural selection
(2) Convergent evolution
(3) Divergent evolution
(4) Adaptive radiation

Correct Answer: (2) Convergent evolution

Question 170:

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

(1) Both A and R are correct but R is NOT the correct explanation of A
(2) A is correct but R is not correct
(3) A is not correct but R is correct
(4) Both A and R are correct and R is the correct explanation of A

Correct Answer: (4) Both A and R are correct and R is the correct explanation of A

Question 171:

Which of the following is not a component of the Fallopian tube?

(1) Isthmus
(2) Infundibulum
(3) Ampulla
(4) Uterine fundus

Correct Answer: (4) Uterine fundus

Question 172:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-IV, B-III, C-I, D-II
(2) A-III, B-I, C-IV, D-II
(3) A-II, B-IV, C-III, D-I
(4) A-I, B-III, C-II, D-IV

Correct Answer: (1) A-IV, B-III, C-I, D-II

Question 173:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-I, B-III, C-II, D-IV
(2) A-III, B-I, C-II, D-IV
(3) A-IV, B-II, C-III, D-I
(4) A-II, B-IV, C-III, D-I

Correct Answer: (2) A-III, B-I, C-II, D-IV

Question 174:

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)
A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus
Choose the correct sequence of human evolution from the options given below:

(1) B-A-D-C
(2) C-B-D-A
(3) A-D-C-B
(4) D-A-C-B

Correct Answer: (3) A-D-C-B

Question 175:

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
In the light of the above statements, choose the correct answer from the options given below:

(1) Both A and R are true but R is NOT the correct explanation of A
(2) A is true but R is false
(3) A is false but R is true
(4) Both A and R are true and R is the correct explanation of A

Correct Answer: (3) A is false but R is true

Question 176:

Which of the following is not a steroid hormone?

(1) Testosterone
(2) Progesterone
(3) Glucagon
(4) Cortisol

Correct Answer: (3) Glucagon

Question 177:

Consider the following statements:

A. Annelids are true coelomates.

B. Poriferans are pseudocoelomates.

C. Aschelminthes are acoelomates.

D. Platyhelminthes are pseudocoelomates.

Choose the correct answer from the options given below:

(1) A only
(2) C only
(3) D only
(4) B only

Correct Answer: (1) A only

Question 178:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-I, B-II, C-IV, D-III
(2) A-II, B-IV, C-I, D-III
(3) A-IV, B-III, C-II, D-I
(4) A-IV, B-II, C-III, D-I

Correct Answer: (2) A-II, B-IV, C-I, D-III

Question 179:

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

(1) High pO2 and Lesser H+ concentration
(2) Low pCO2 and High H+ concentration
(3) Low pCO2 and High temperature
(4) High pO2 and High pCO2

Correct Answer: (1) High pO2 and Lesser H+ concentration

Question 180:

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

(1) 10th segment
(2) 8th and 9th segment
(3) 11th segment
(4) 5th segment

Correct Answer: (1) 10th segment

Question 181:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-II, B-I, C-IV, D-III
(2) A-II, B-IV, C-I, D-III
(3) A-IV, B-III, C-II, D-I
(4) A-IV, B-II, C-III, D-I

Correct Answer: (1) A-II, B-I, C-IV, D-III

Question 182:

The “Ti plasmid” of Agrobacterium tumefaciens stands for:

(1) Tumor independent plasmid
(2) Tumor inducing plasmid
(3) Temperature independent plasmid
(4) Tumor inhibiting plasmid

Correct Answer: (2) Tumor inducing plasmid

Question 183:

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: The presence or absence of hymen is not a reliable indicator of virginity.

Reason R: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are false
(2) Statement I is true but Statement II is false
(3) Statement I is false but Statement II is true
(4) Both Statement I and Statement II are true

Correct Answer: (2) Statement I is true but Statement II is false

Question 184:

The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:

(1) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
(2) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
(3) Gene ’X’ is responsible for recognition sites and ‘Y’ is responsible for antibiotic resistance.
(4) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.

Correct Answer: (1) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.

Question 185:

Which of the following is not a natural/traditional contraceptive method?

(1) Periodic abstinence
(2) Lactational amenorrhea
(3) Vaults
(4) Coitus interruptus

Correct Answer: (3) Vaults

Question 186:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-IV, B-II, C-I, D-III
(2) A-III, B-IV, C-II, D-I
(3) A-III, B-IV, C-I, D-II
(4) A-I, B-III, C-II, D-IV

Correct Answer: (3) A-III, B-IV, C-I, D-II

Question 187:

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

(1) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
(2) FSH, Sertoli cells, Leydig cells, spermatogenesis.
(3) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
(4) FSH, Leydig cells, Sertoli cells, spermiogenesis.

Correct Answer: (4) FSH, Leydig cells, Sertoli cells, spermiogenesis.

Question 188:

Given below are two statements:

Statement I: Mitochondria and chloroplasts both are double-membrane bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.

In the light of the above statements, choose the most appropriate answer from the options given below:

(1) Both Statement I and Statement II are incorrect.
(2) Statement I is correct but Statement II is incorrect.
(3) Statement I is incorrect but Statement II is correct.
(4) Both Statement I and Statement II are correct.

Correct Answer: (2) Statement I is correct but Statement II is incorrect.

Question 189:

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below:

(1) Both Statement I and Statement II are false.
(2) Statement I is true but Statement II is false.
(3) Statement I is false but Statement II is true.
(4) Both Statement I and Statement II are true.

Correct Answer: (3) Statement I is false but Statement II is true.

Question 190:

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:

A. Substrate-enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.

Choose the correct answer from the options given below:

(1) A, E, B, D, C
(2) B, A, C, D, E
(3) E, D, C, B, A
(4) E, A, D, C, B

Correct Answer: (4) E, A, D, C, B

Question 191:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-III, B-II, C-IV, D-I
(2) A-II, B-III, C-I, D-IV
(3) A-IV, B-II, C-I, D-III
(4) A-I, B-III, C-IV, D-II

Correct Answer: (1) A-III, B-II, C-IV, D-I

Question 192:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-III, B-II, C-IV, D-I
(2) A-III, B-IV, C-I, D-II
(3) A-IV, B-III, C-I, D-II
(4) A-II, B-IV, C-I, D-III

Correct Answer: (3) A-IV, B-III, C-I, D-II

Question 193:

Given below are two statements:

Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

(1) Both Statement I and Statement II are incorrect.
(2) Statement I is correct but Statement II is incorrect.
(3) Statement I is incorrect but Statement II is correct.
(4) Both Statement I and Statement II are correct.

Correct Answer: (2) Statement I is correct but Statement II is incorrect.

Question 194:

Match List I with List II related to digestive system of cockroach:

Choose the correct answer from the options given below:

(1) A-I, B-II, C-III, D-IV
(2) A-IV, B-III, C-II, D-I
(3) A-III, B-II, C-IV, D-I
(4) A-IV, B-II, C-III, D-I

Correct Answer: (4) A-IV, B-II, C-III, D-I

Question 195:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-III, B-I, C-II, D-IV
(2) A-I, B-II, C-IV, D-III
(3) A-III, B-I, C-IV, D-II
(4) A-II, B-I, C-III, D-IV

Correct Answer: (3) A-III, B-I, C-IV, D-II

Question 196:

Given below are two statements:
Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.
Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.
In the light of the above statements, choose the most appropriate answer from the options given below:

(1) Both Statement I and Statement II are incorrect.
(2) Statement I is correct but Statement II is incorrect.
(3) Statement I is incorrect but Statement II is correct.
(4) Both Statement I and Statement II are correct.

Correct Answer: (4) Both Statement I and Statement II are correct.

Question 197:

Match List I with List II:

Choose the correct answer from the options given below:

(1) A-IV, B-III, C-I, D-II
(2) A-III, B-IV, C-I, D-II
(3) A-II, B-I, C-IV, D-III
(4) A-II, B-I, C-III, D-IV

Correct Answer: (2) A-III, B-IV, C-I, D-II

Question 198:

Choose the correct statement given below regarding juxta medullary nephron:

(1) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
(2) Loop of Henle of juxta medullary nephron runs deep into medulla.
(3) Juxta medullary nephrons outnumber the cortical nephrons.
(4) Juxta medullary nephrons are located in the columns of Bertini.

Correct Answer: (2) Loop of Henle of juxta medullary nephron runs deep into medulla.

Question 199:

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:

(1) B only
(2) C \& B only
(3) D \& E only
(4) A only

Correct Answer: (4) A only

Question 200:

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

Choose the most appropriate answer from the options given below:

(1) A, B & D only
(2) B, D & E only
(3) B, C & D only
(4) A & C only

Correct Answer: (2) B, D & E only

NEET Previous Year Question Papers with Answer Keys

NEET 2023 Question Papers	NEET 2022 Question Papers	NEET 2021 Question Papers
NEET 2020 Question Papers	NEET 2019 Question Papers	NEET 2018 Question Papers

Other UG Entrance Exams

MHT CET Previous Year Question Papers	OJEE Previous Year Question Papers
TS EAMCET Previous Year Question Papers	AP EAMCET Previous Year Question Papers

SHARE ON FACEBOOK SHARE ON TWITTER

NEET Questions

1.
Given below are two statements:
Statement I: Benzendiazonium salt is prepared by the reaction of aniline with nitrous acid at 273-278 K. It decomposes easily in the dry state.
Statement II: Insertion of iodine into the benzene ring is difficult and hence iodobenzene is prepared through the reaction of benzendiazonium salt with KI.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Both Statement I and Statement II are incorrect.
- Statement I is correct but Statement II is incorrect.
- Statement I is incorrect but Statement II is correct.
- Both Statement I and Statement II are correct.
View Solution
2.
Identify the correct orders against the property mentioned:
A. H$_2$O $>$ NH$_3$ $>$ CHCl$_3$ - dipole moment
B. XeF$_4$ $>$ XeO$_3$ $>$ XeF$_2$ - number of lone pairs on central atom
C. O–H $>$ C–H $>$ N–O - bond length
D. N$_2$>O$_2$>H$_2$ - bond enthalpy
Choose the correct answer from the options given below:
- B, D only
- A, C only
- B, C only
- A, D only
View Solution
3.
The correct order of decreasing acidity of the following aliphatic acids is:
- $CH_{3}COOH$ $>$ (CH_{3})_{2}CHCOOH $>$$ (CH_{3})_{3}CCOOH$ $>$ HCOOH
- $CH_3COOH > (CH_3)_2CHCOOH > (CH_3)_3CCOOH$
- $HCOOH > (CH_3)_3CCOOH > (CH_3)_2CHCOOH > CH_3COOH$
- $(CH_3)_3CCOOH > (CH_3)_2CHCOOH > CH_3COOH > HCOOH$
View Solution
4.
The correct order of decreasing basic strength of the given amines is:
- N-ethylmethanamine $>$ ethanamine $>$ benzenamine $>$ N-methylaniline
- N-ethylmethanamine $>$ ethanamine $>$ N-methylaniline $>$ benzenamine
- N-methylaniline $>$ ethanamine $>$ benzenamine $>$ N-ethylmethanamine
- N-methylaniline $>$ N-ethylmethanamine $>$ benzenamine $>$ ethanamine
View Solution
5.
Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable.
Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repair mechanisms. In the light of the above statements, choose the most appropriate answer from the options given below:
- Both Statement I and Statement II are incorrect
- Statement I is correct but Statement II is incorrect
- Statement I is incorrect but Statement II is correct
- Both Statement I and Statement II are correct
View Solution
6.
Sugar ‘X’:
A. is found in honey.
B. is a keto sugar.
C. exists in $\alpha$ and $\beta$ anomeric forms.
D. is laevorotatory.
‘X’ is:
- D-Fructose
- Sucrose
- Maltose
- D-Glucose
View Solution

Comments

No Comments To Show

SUBSCRIBE TO OUR NEWS LETTER

COLLEGE NOTIFICATIONS

EXAM NOTIFICATIONS

NEWS UPDATES

Download the Collegedunia app on

downloadapp_banner image

downloadapp_banner image

© 2026 Collegedunia Web Pvt. Ltd. All Rights Reserved