NEET 2024 Zoology Question Paper with Answers and Solutions PDF Q2

Cocaine is derived from Erythroxylum (III).
Heroin is derived from Papaver somniferum (IV).
Morphine is an effective sedative in surgery (I).
Marijuana is derived from Cannabis sativa (II). Quick Tip: Morphine and heroin are derived from the opium poppy, while marijuana comes from Cannabis sativa.

Down’s syndrome is caused by a trisomy of the 21st chromosome (III).

α-Thalassemia is associated with mutations on the 16th chromosome (IV).

β-Thalassemia is caused by mutations on the 11th chromosome (I).

Klinefelter’s syndrome is linked to the ‘X’ chromosome (II). Quick Tip: Down’s syndrome is characterized by an extra chromosome 21. Klinefelter’s syndrome results from the presence of an extra X chromosome in males.

Skeletal muscles (voluntary) are attached to bones like triceps.
Smooth muscles (involuntary) are found in organs like the stomach.
Cardiac muscles are located in the heart. Quick Tip: Muscles are classified into skeletal, smooth, and cardiac based on structure, control, and location.

Pterophyllum is the Angel fish (III).
Myxine is the Hag fish (I).
Pristis is the Saw fish (II).
Exocoetus is the Flying fish (IV). Quick Tip: Fish species vary widely, and each has unique adaptations like flight or deep-sea living.

The Fallopian tube consists of components like the isthmus, infundibulum, and ampulla, but not the uterine fundus. Quick Tip: The Fallopian tube helps in transporting eggs from the ovaries to the uterus and is not associated with the uterine fundus.

Pleurobrachia is a ctenophore (II).
Radula is a characteristic of Mollusca (I).
Stomochord is a feature of Hemichordata (IV).
Air bladder is found in Osteichthyes (III). Quick Tip: Ctenophores are marine invertebrates, and the radula is a feeding organ found in mollusks.

Myasthenia gravis, rheumatoid arthritis, and systemic lupus erythematosus (SLE) are autoimmune disorders.
Gout and muscular dystrophy are not autoimmune disorders. Quick Tip: Autoimmune diseases occur when the immune system mistakenly attacks the body’s own cells.

Statement I is false: The descending limb of the loop of Henle is permeable to water and impermeable to electrolytes.


Statement II is also false: The proximal convoluted tubule is lined by cuboidal epithelium with a brush border, not simple columnar. Quick Tip: The loop of Henle plays a critical role in the concentration of urine and the proximal convoluted tubule aids in reabsorption.

Glucagon is a peptide hormone, not a steroid hormone. Cortisol, testosterone, and progesterone are all steroid hormones, derived from cholesterol. Quick Tip: Steroid hormones are lipophilic and are derived from cholesterol. Peptide hormones like glucagon are water-soluble.

Statement I is true because hymen can naturally tear due to physical activities or exercise, not necessarily the first coitus. Statement II is false because the hymen may tear due to various reasons, not only during the first sexual intercourse. Quick Tip: The hymen can tear due to activities like cycling, sports, or medical examination, not just during coitus.

High partial pressure of oxygen (pO2) and lower concentration of hydrogen ions (H+) favour the formation of oxyhaemoglobin in the alveoli. Quick Tip: Oxyhaemoglobin is formed when oxygen binds to hemoglobin, primarily in the lungs where oxygen levels are high and pH is less acidic.

Axoneme is associated with cilia and flagella (II).
Cartwheel pattern is found in centrioles (I).
Crista is a feature of mitochondria (IV).
Satellite is associated with chromosomes (III). Quick Tip: The structure and function of cell components like mitochondria, centrioles, and cilia are crucial for cellular processes.

The flippers of penguins and dolphins are examples of convergent evolution, where species from different evolutionary backgrounds evolve similar traits. Quick Tip: Convergent evolution results in the development of similar traits in unrelated species due to similar environmental pressures.

Homo habilis (A) was one of the earliest members of the genus Homo, followed by Homo erectus (D), then Homo neanderthalensis (C), and finally Homo sapiens (B). Quick Tip: Human evolution is a continuous process, with different species evolving over time.

In cockroaches, anal cerci are present on the 10th segment in both sexes, which help in sensory functions. Quick Tip: The anal cerci in cockroaches play a role in detecting air currents and vibrations.

Bio-reactors are typically used for large-scale production of microorganisms, not just small-scale bacterial cultures. They are designed to maintain optimal conditions for high-yield production. Quick Tip: Bio-reactors are essential for large-scale fermentation processes, such as the production of antibiotics or biofuels.

A. Typhoid is caused by \textit{Salmonella typhi, a bacteria.

B. Leishmaniasis is caused by \textit{Leishmania, a protozoa.

C. Ringworm is caused by a fungus.

D. Filariasis is caused by \textit{Wuchereria bancrofti, a nematode.

Thus, the correct match is: (2) A-IV, B-III, C-I, D-II. Quick Tip: Leishmaniasis and Filariasis are protozoal and nematode infections, respectively, while Ringworm and Typhoid are fungal and bacterial infections.

Annelids are true coelomates, meaning they have a body cavity completely lined with mesoderm (A).
Poriferans are neither coelomates nor pseudocoelomates, they lack a true body cavity.
Aschelminthes (roundworms) are pseudocoelomates, not acoelomates.
Platyhelminthes (flatworms) are acoelomates, lacking a body cavity. Quick Tip: Coelomates have a true coelom, pseudocoelomates have a false cavity, and acoelomates lack a body cavity.

Vaults are not a natural or traditional contraceptive method. Coitus interruptus, periodic abstinence, and lactational amenorrhea are all traditional methods. Quick Tip: Traditional contraceptive methods are those that do not involve modern medical interventions but rely on behavior or biological processes.

Pons connects different regions of the brain (III).
Hypothalamus has neurosecretory cells (IV).
Medulla controls respiration and gastric secretions (II).
Cerebellum provides additional space for neurons, regulates posture and balance (I). Quick Tip: The pons and medulla are part of the brainstem, which controls vital functions like respiration and heartbeat.

A constant gene pool means no changes in allele frequencies, so it does not affect the Hardy-Weinberg equilibrium. Genetic recombination, genetic drift, and gene migration all influence allele frequencies. Quick Tip: The Hardy-Weinberg equilibrium assumes that no evolutionary forces are acting on the population (no genetic drift, migration, mutation, or natural selection).

\(\alpha\)-I antitrypsin deficiency leads to emphysema (III).
Cry IAb is associated with cotton bollworm (I).
Cry IAc is associated with corn borer (IV).
Enzyme replacement therapy is used for ADA deficiency (II). Quick Tip: Cry proteins are insecticidal and are used in genetically modified crops to protect them from pests like bollworm and corn borer.

The correct sequence for conduction of an action potential in the heart is: \[ SA node \rightarrow AV node \rightarrow AV bundle \rightarrow Bundle branches \rightarrow Purkinje fibers \]
Thus, the correct sequence is: (1) E-C-A-D-B. Quick Tip: The action potential in the heart follows a specific sequence to ensure coordinated contraction: SA node → AV node → AV bundle → Bundle branches → Purkinje fibers.

The Ti plasmid in Agrobacterium tumefaciens induces the formation of tumors in plants by transferring part of the plasmid DNA to the plant genome. Quick Tip: The Ti plasmid is a key tool in plant genetic engineering, used to insert foreign genes into plant cells.

Expiratory capacity = Tidal volume + Expiratory reserve volume (II).
Functional residual capacity = Expiratory reserve volume + Residual volume (IV).
Vital capacity = Expiratory reserve volume + Tidal volume + Inspiratory reserve volume (I).
Inspiratory capacity = Tidal volume + Inspiratory reserve volume (III). Quick Tip: Vital capacity is the maximum amount of air a person can exhale after a maximum inhalation.

The correct sequence of stages in cell division is:

1. Gap 1 phase (E)

2. Synthesis phase (C)

3. Gap 2 phase (A)

4. Karyokinesis (D)

5. Cytokinesis (B)
Quick Tip: Cell division includes interphase (G1, S, G2) and mitosis (karyokinesis and cytokinesis).

Fibrous joints are immovable like those in the skull (III).
Cartilaginous joints are slightly movable, such as between adjacent vertebrae (I).
Hinge joints allow movement like in the knee (IV).
Ball and socket joints allow rotational movement like in the humerus and pectoral girdle (II). Quick Tip: Joints in the human body are classified based on their structure and the type of movement they allow.

Statement I is false because FSH acts on granulosa cells in females and Sertoli cells in males, not on Leydig cells. Statement II is true as estrogen is secreted by growing ovarian follicles and androgens by Leydig cells. Quick Tip: FSH stimulates the granulosa cells in females and Sertoli cells in males, while LH stimulates the Leydig cells in males.

Diakinesis involves terminalisation of chiasmata (II).
Pachytene is marked by the appearance of recombination nodules (IV).
Zygotene is when the synaptonemal complex forms (I).
Leptotene is characterized by chromosomes appearing as thin threads (III). Quick Tip: Prophase I of meiosis has distinct stages: leptotene, zygotene, pachytene, diplotene, and diakinesis.

Gene 'X' in the plasmid pBR322 is responsible for controlling the copy number of the plasmid, while Gene 'Y' is involved in the replication process. Quick Tip: pBR322 is a commonly used plasmid vector in genetic engineering that contains antibiotic resistance genes and replication control mechanisms.

Common cold is caused by Rhinoviruses (III).
Haemozoin is released in blood due to ruptured RBCs after Plasmodium infection (I).
Widal test is used to confirm typhoid fever (II).
Allergy is caused due to dust mites (IV). Quick Tip: Rhinoviruses are the main cause of common cold, while Haemozoin is produced in Plasmodium infection.

Non-medicated IUD is Lippes loop (III).
Copper releasing IUD is Multiload 375 (I).
Hormone releasing IUD is LNG-20 (IV).
Implants contain Progestogens (II). Quick Tip: IUDs (Intrauterine Devices) are either medicated or non-medicated and work by releasing copper or hormones to prevent pregnancy.

Breast-feeding is essential for infant health, and colostrum contains antibodies that help develop resistance against infections, making both statements true. The reason correctly explains the assertion. Quick Tip: Breast-feeding provides crucial nutrients and antibodies through colostrum, which is the first milk produced after birth.

Lipase acts on ester bonds (II).
Nuclease acts on phosphodiester bonds (IV).
Protease breaks peptide bonds (I).
Amylase acts on glycosidic bonds (III). Quick Tip: Lipase, Nuclease, Protease, and Amylase are enzymes that break down different bonds in molecules like fats, nucleic acids, proteins, and carbohydrates.

The correct RNA sequence transcribed from the template strand is 5' AUGUACCGUUUAUAGGUAAGU 3'. RNA polymerase synthesizes the RNA strand in the 5’ → 3’ direction, complementary to the DNA template. Quick Tip: DNA-dependent RNA polymerase uses the DNA template strand to synthesize an RNA strand complementary to the template.

A. The structures used for storing of food: The crop is the part of the cockroach's digestive system responsible for storing food.


B. Ring of 6-8 blind tubules at junction of foregut and midgut: These are the gastric caeca, which help in digestion by secreting digestive enzymes.


C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut: These are the Malpighian tubules, responsible for excretion and osmoregulation.


D. The structures used for grinding the food: The gizzard grinds food, breaking down particles mechanically. Quick Tip: In cockroaches, the crop stores food, the gastric caeca aids in digestion, the gizzard grinds food, and the Malpighian tubules are responsible for excretion and waste removal.

- A. RNA polymerase III: It synthesizes tRNA and small RNAs such as snRNAs.
- B. Termination of transcription: Rho factor is involved in terminating transcription in prokaryotes.
- C. Splicing of Exons: snRNPs (small nuclear ribonucleoproteins) are involved in splicing introns and exons in eukaryotic mRNA processing.
- D. TATA box: The TATA box is a promoter region that plays a role in the initiation of transcription in eukaryotes. Quick Tip: RNA polymerase III is responsible for the synthesis of small RNAs such as tRNA, while the TATA box in the promoter region is essential for the initiation of transcription in eukaryotes.

Statement A is incorrect because the pharynx is not perforated by gill slits in all non-chordates; it is characteristic of chordates.


Statement B is correct as non-chordates lack a notochord.


Statement C is incorrect because the central nervous system in non-chordates is typically ventral.


Statement D is correct as the heart, if present, is dorsal in non-chordates.


Statement E is correct as many non-chordates lack a post-anal tail. Quick Tip: Non-chordates lack a notochord and the dorsal position of the heart, unlike chordates.

Statement I is correct because the cerebral hemispheres are indeed connected by the corpus callosum, which allows communication between the two hemispheres.


Statement II is incorrect because the brainstem consists of the medulla oblongata, pons, and midbrain, not the cerebrum. Quick Tip: The corpus callosum is essential for the exchange of information between the two cerebral hemispheres.

-E. The substrate binds to the active site of the enzyme, initiating the catalytic process.


-A. The enzyme-substrate complex is formed after the substrate binds to the active site.


-D. The enzyme catalyzes the breaking of chemical bonds in the substrate, facilitating the transition state.


-C. The product is released from the enzyme after the reaction.


-B. The enzyme is now free and ready to bind with a new substrate. Quick Tip: The enzyme catalytic cycle involves the binding of substrate, conversion into products, and release. The enzyme is reused in subsequent cycles.

Statement I is false because Gause's competitive exclusion principle states that two species competing for the same limiting resource cannot coexist indefinitely, not necessarily for different resources.


Statement II is true as, according to Gause's principle, the inferior competitor is often eliminated when resources are limited. Quick Tip: Gause's principle highlights that no two species can occupy the same niche for long if they are competing for the same resources.

FSH (Follicle Stimulating Hormone) stimulates Sertoli cells, which support the process of spermatogenesis.


Leydig cells secrete testosterone, which is essential for spermatogenesis.


Spermiogenesis refers to the maturation of spermatids into sperm. Quick Tip: Spermatogenesis involves the transformation of spermatogonia into mature sperm cells through a series of stages, including spermiogenesis.

A. P wave: Represents the depolarisation of the atria.


B. QRS complex: Represents the depolarisation of ventricles.


C. T wave: Represents the repolarisation of ventricles.


D. T-P gap: Indicates a period where heart muscles are electrically silent, representing no electrical activity. Quick Tip: The P wave, QRS complex, and T wave are key components of the electrocardiogram (ECG) that correspond to different phases of heart muscle electrical activity.

-A. Incorrect: Juxta medullary nephrons are located at the junction of the cortex and medulla, not in the columns of Bertini.
-B. Incorrect: The renal corpuscle of juxta medullary nephrons is located in the outer cortex, not in the outer medulla.
-C. Correct: The loop of Henle of juxta medullary nephrons extends deep into the medulla, which helps in concentrating the urine.
-D. Incorrect: Juxta medullary nephrons are fewer in number compared to cortical nephrons. Quick Tip: The juxta medullary nephrons are vital for water conservation as their deep loop of Henle helps in the concentration of urine.

Statement I: Correct. Bone marrow is indeed the primary lymphoid organ responsible for the production of blood cells, including lymphocytes.


Statement II: Correct. The bone marrow produces T-lymphocytes, which mature in the thymus. Both organs provide the necessary environments for T-cell development. Quick Tip: Bone marrow is the site of hematopoiesis (blood cell production), while the thymus is responsible for the maturation of T-lymphocytes, essential for the adaptive immune response.

A. Unicellular glandular epithelium: Goblet cells in the alimentary canal secrete mucus.


B. Compound epithelium: Found on the moist surface of the buccal cavity.


C. Multicellular glandular epithelium: Includes salivary glands which secrete saliva.


D. Endocrine glandular epithelium: Found in the pancreas, involved in hormone secretion. Quick Tip: Glandular epithelium includes unicellular (e.g., goblet cells), multicellular (e.g., salivary glands), and endocrine glands that secrete hormones (e.g., pancreas).

A. Mesozoic Era: Known as the age of reptiles and birds, including dinosaurs.


B. Proterozoic Era: Dominated by lower invertebrates.


C. Cenozoic Era: Age of mammals, characterized by their rise.


D. Paleozoic Era: Dominated by fish and amphibians. Quick Tip: The Mesozoic era is known for dinosaurs, the Cenozoic era for mammals, and the Paleozoic era for early vertebrates like fish and amphibians.

The father with blood group B+ could have a genotype IBi or IBIB, while the mother with blood group A+ could have IAi or IAIA.


The child with blood group O+ must inherit an i allele from both parents, making the father’s genotype IBi and the mother’s genotype IAi. Quick Tip: In the ABO blood group system, O blood type is recessive, and both parents must carry the i allele to produce a child with blood group O.