NEET 2024 Zoology Question Paper with Solutions PDF Q3 is available for download. NEET 2024 Q3 Zoology Question Paper comprises 50 MCQs out of which only 45 are to be attempted. NEET 2024 question Q3 Zoology is divided into 2 sections- A (35 questions) and B (15 questions). You can download NEET 2024 zoology question paper with answer key and solutions PDF for Q3 using the links given below.

NEET 2024 Zoology Question Paper with Solutions PDF Q3

NEET 2024 Q3 Question Paper with Answer Key Download PDF Check Solution
Question 1:

Following are the stages of pathway for conduction of an action potential through the heart

A. AV bundle

B. Purkinje fibers

C. AV node

D. Bundle branches

E. SA node


Choose the correct sequence of pathway from the options given below:

  • (1) E-C-A-D-B
  • (2) A-E-C-B-D
  • (3) B-D-E-C-A
Correct Answer:
View Solution

N/A Quick Tip: The action potential in the heart follows a specific sequence to ensure coordinated contraction: SA node → AV node → AV bundle → Bundle branches → Purkinje fibers.

Question 2:

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

  • (1) 5th segment
  • (2) 10th segment
  • (3) 8th and 9th segment
Correct Answer:
View Solution

N/A Quick Tip: The anal cerci in cockroaches play a role in detecting air currents and vibrations.

Question 3:

The flippers of the Penguins and Dolphins are the example of the

  • (1) Adaptive radiation
  • (2) Natural selection
  • (3) Convergent evolution
Correct Answer:
View Solution

N/A Quick Tip: Convergent evolution results in the development of similar traits in unrelated species due to similar environmental pressures.

Question 4:

Which of the following is not a component of Fallopian tube?

  • (1) Uterine fundus
  • (2) Isthmus
  • (3) Infundibulum
Correct Answer:
View Solution

N/A Quick Tip: The Fallopian tube helps in transporting eggs from the ovaries to the uterus and is not associated with the uterine fundus.

Question 5:

Given below are some stages of human evolution.

Arrange them in correct sequence. (Past to Recent)

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus


Choose the correct sequence of human evolution from the options given below:

  • (1) D-A-C-B
  • (2) B-A-D-C
  • (3) C-B-D-A
Correct Answer:
View Solution

N/A Quick Tip: Human evolution is a continuous process, with different species evolving over time.

Question 6:

Which of the following is not a steroid hormone?

  • (1) Cortisol
  • (2) Testosterone
  • (3) Progesterone
Correct Answer:
View Solution

N/A Quick Tip: Steroid hormones are lipophilic and are derived from cholesterol. Peptide hormones like glucagon are water-soluble.

Question 7:

Match List I with List II:
 List I            List II 
A. \alpha-I antitrypsin                    I. Cotton bollworm
B. Cry IAb                                       II. ADA deficiency
C. Cry IAc                                        III. Emphysema
D. Enzyme replacement therapy   IV. Corn borer

Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-IV, D-III
  • (2) A-III, B-I, C-II, D-IV
  • (3) A-III, B-IV, C-I, D-II
Correct Answer:
View Solution

N/A Quick Tip: Cry proteins are insecticidal and are used in genetically modified crops to protect them from pests like bollworm and corn borer.

Question 8:

Following are the stages of cell division:


A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below:

  • (1) C-E-D-A-B
  • (2) E-B-D-A-C
  • (3) B-D-E-A-C
Correct Answer:
View Solution

N/A Quick Tip: Cell division includes interphase (G1, S, G2) and mitosis (karyokinesis and cytokinesis).

Question 9:

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

  • (1) Genetic recombination
  • (2) Genetic drift
  • (3) Gene migration
Correct Answer:
View Solution

N/A Quick Tip: The Hardy-Weinberg equilibrium assumes that no evolutionary forces are acting on the population (no genetic drift, migration, mutation, or natural selection).

Question 10:

Which of the following are Autoimmune disorders?


A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

  • (1) A,B& D only
  • (2) A,B& E only
  • (3) B,C & E only
Correct Answer:
View Solution

N/A Quick Tip: Autoimmune diseases occur when the immune system mistakenly attacks the body’s own cells.

Question 11:

Match List I with List II:
 List I                         List II 
A. Typhoid                I. Fungus
B. Leishmaniasis     II. Nematode
C. Ringworm            III. Protozoa
D. Filariasis             IV. Bacteria

Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-IV, B-III, C-I, D-II
  • (3) A-III, B-I, C-IV, D-II
Correct Answer:
View Solution

N/A Quick Tip: Leishmaniasis and Filariasis are protozoal and nematode infections, respectively, while Ringworm and Typhoid are fungal and bacterial infections.

Question 12:

Match List I with List II:
 List I                                   List II 
A. Expiratory capacity  I. Expiratory reserve volume + Tidal volume + Inspiratory volume
B. Functional residual capacity   II. Tidal volume + Expiratory reserve volume
C. Vital capacity   III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity   IV. Expiratory reserve volume + Residual volume

Choose the correct answer from the options given below:

  • (1) A-II, B-IV, C-I, D-III
  • (2) A-III, B-II, C-IV, D-I
  • (3) A-II, B-I, C-IV, D-III
Correct Answer:
View Solution

N/A Quick Tip: Vital capacity is the maximum amount of air a person can exhale after a maximum inhalation.

Question 13:

Given below are two statements:

Statement I: FSH acts upon ovarian follicles in female and Leydig cells in male.

Statement II: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human beings.

Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are true and R is the correct explanation of A
  • (2) Both Statement I and Statement II are true but R is NOT the correct explanation of A
  • (3) Statement I is true but Statement II is false
Correct Answer:
View Solution

N/A Quick Tip: FSH stimulates the granulosa cells in females and Sertoli cells in males, while LH stimulates the Leydig cells in males.

Question 14:

Match List I with List II:
 List I                   List II 
A. Pleurobrachia  I. Mollusca
B. Radula              II. Ctenophora
C. Stomochord   III. Osteichthyes
D. Air bladder      IV. Hemichordata

Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-II, B-I, C-IV, D-III
  • (3) A-II, B-IV, C-I, D-III
Correct Answer:
View Solution

N/A Quick Tip: Ctenophores are marine invertebrates, and the radula is a feeding organ found in mollusks.

Question 15:

Match List I with List II:
 List I (Sub-Phases of Prophase I)      List II (Specific Characters)
A. Diakinesis                                        I. Synaptonemal complex formation
B. Pachytene                                       II. Completion of terminalisation of chiasmata
C. Zygotene                                         III. Chromosomes look like thin threads
D. Leptotene                                       IV. Appearance of recombination nodules

Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-I, B-II, C-IV, D-III
  • (3) A-II, B-IV, C-I, D-II
Correct Answer:
View Solution

N/A Quick Tip: Prophase I of meiosis has distinct stages: leptotene, zygotene, pachytene, diplotene, and diakinesis.

Question 16:

The “Ti plasmid” of Agrobacterium tumefaciens stands for

  • (1) Tumour inhibiting plasmid
  • (2) Tumor independent plasmid
  • (3) Tumor inducing plasmid
Correct Answer:
View Solution

N/A Quick Tip: The Ti plasmid is a key tool in plant genetic engineering, used to insert foreign genes into plant cells.

Question 17:

Match List I with List II:
 List I                 List II 
A. Cocaine   I. Effective sedative in surgery
B. Heroin     II. Cannabis sativa
C. Morphine   III. Erythroxylum
D. Marijuana   IV. Papaver somniferum

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-I, D-II
  • (2) A-I, B-III, C-II, D-IV
  • (3) A-II, B-I, C-III, D-IV
Correct Answer:
View Solution

N/A Quick Tip: Morphine and heroin are derived from the opium poppy, while marijuana comes from Cannabis sativa.

Question 18:

Which one is the correct product of DNA dependent RNA polymerase to the given template?
\[ 3’ TACATGGCAAATATCCATTCA 5’ \]

  • (1) 5’ AUGUACCGUUUAUAGGUAAGU 3’
  • (2) 5’ AUGUAAAGUUUAUAGGUAAGU 3’
  • (3) 5’ AUGUACCGUUUAUAGGGAAGU 3’
Correct Answer:
View Solution

N/A Quick Tip: DNA-dependent RNA polymerase uses the DNA template strand to synthesize an RNA strand complementary to the template.

Question 19:

Match List I with List II:
 List I                              List II
A. Pons   I. Provides additional space for Neurons, regulates posture and balance.
B. Hypothalamus   II. Controls respiration and gastric secretions.
C. Medulla  III. Connects different regions of the brain.
D. Cerebellum   IV. Neurosecretory cells

Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-I, D-IV
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-I, B-III, C-II, D-IV
Correct Answer:
View Solution

N/A Quick Tip: The pons and medulla are part of the brainstem, which controls vital functions like respiration and heartbeat.

Question 20:

Match List I with List II:
 List I                   List II 
A. Lipase            I. Peptide bond
B. Nuclease       II. Ester bond
C. Protease       III. Glycosidic bond
D. Amylase       IV. Phosphodiester bond

Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-III, B-II, C-I, D-IV
  • (3) A-II, B-IV, C-I, D-III
Correct Answer:
View Solution

N/A Quick Tip: Lipase, Nuclease, Protease, and Amylase are enzymes that break down different bonds in molecules like fats, nucleic acids, proteins, and carbohydrates.

Question 21:

Which of the following is not a natural/traditional contraceptive method?

  • (1) Coitus interruptus
  • (2) Periodic abstinence
  • (3) Lactational amenorrhea
Correct Answer:
View Solution

N/A Quick Tip: Traditional contraceptive methods are those that do not involve modern medical interventions but rely on behavior or biological processes.

Question 22:

Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:


 

\[ \textbf{Muscle Name/Location:} \]

  • (1) (a) Smooth - Toes, (b) Skeletal – Legs, (c) Cardiac – Heart
  • (2) (a) Skeletal - Triceps, (b) Smooth – Stomach, (c) Cardiac – Heart
  • (3) (a) Skeletal - Biceps, (b) Involuntary – Intestine, (c) Smooth – Heart
Correct Answer:
View Solution

N/A Quick Tip: Muscles are classified into skeletal, smooth, and cardiac based on structure, control, and location.

Question 23:

Which of the following statements is incorrect?

  • (1) A bio-reactor provides optimal growth conditions for achieving the desired product
  • (2) Most commonly used bio-reactors are of stirring type
  • (3) Bio-reactors are used to produce small scale bacterial cultures
Correct Answer:
View Solution

N/A Quick Tip: Bio-reactors are essential for large-scale fermentation processes, such as the production of antibiotics or biofuels.

Question 24:

Given below are two statements:
One is labelled as Assertion A and the other is labelled as Reason R:


Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.


Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.
In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both A and R are correct and R is the correct explanation of A
  • (2) Both A and R are correct but R is NOT the correct explanation of A
  • (3) A is correct but R is not correct
Correct Answer:
View Solution

N/A Quick Tip: Breast-feeding provides crucial nutrients and antibodies through colostrum, which is the first milk produced after birth.

Question 25:

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

  • (1) High pO2 and High pCO2
  • (2) High pO2 and Lesser H+ concentration
  • (3) Low pCO2 and High H+ concentration
Correct Answer:
View Solution

N/A Quick Tip: Oxyhaemoglobin is formed when oxygen binds to hemoglobin, primarily in the lungs where oxygen levels are high and pH is less acidic.

Question 26:

Match List I with List II:
 List I                       List II
A. Common cold   I. Plasmodium
B. Haemozoin       II. Typhoid
C. Widal test         III. Rhinoviruses
D. Allergy             IV. Dust mites

Choose the correct answer from the options given below :

  • (1) A-II, B-IV, C-III, D-I
  • (2) A-I, B-III, C-II, D-IV
  • (3) A-III, B-I, C-II, D-IV
Correct Answer:
View Solution

N/A Quick Tip: Rhinoviruses are the main cause of common cold, while Haemozoin is produced in Plasmodium infection.

Question 27:

Match List I with List II:
 List I                                    List II 
A. Non-medicated IUD        I. Multiload 375
B. Copper releasing IUD   II. Progestogens
C. Hormone releasing IUD   III. Lippes loop
D. Implants  IV. LNG-20


Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-II, D-IV
  • (2) A-I, B-III, C-IV, D-II
  • (3) A-IV, B-I, C-II, D-III
Correct Answer:
View Solution

N/A Quick Tip: IUDs (Intrauterine Devices) are either medicated or non-medicated and work by releasing copper or hormones to prevent pregnancy.

Question 28:

Given below are two statements:


Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the option given below:

  • (1) Both Statement I and Statement II are true
  • (2) Both Statement I and Statement II are false
  • (3) Statement I is true but Statement II is false
Correct Answer:
View Solution

N/A Quick Tip: The loop of Henle plays a critical role in the concentration of urine and the proximal convoluted tubule aids in reabsorption.

Question 29:

The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:

  • (1) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.
  • (2) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
  • (3) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
Correct Answer:
View Solution

N/A Quick Tip: pBR322 is a commonly used plasmid vector in genetic engineering that contains antibiotic resistance genes and replication control mechanisms.

Question 30:

Match List I with List II:
 List I                           List II 
A. Axoneme                 I. Centriole
B. Cartwheel pattern   II. Cilia and flagella
C. Crista                      III. Chromosome
D. Satellite                     IV. Mitochondria

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-II, D-I
  • (2) A-IV, B-II, C-III, D-I
  • (3) A-II, B-IV, C-I, D-III
Correct Answer:
View Solution

N/A Quick Tip: The structure and function of cell components like mitochondria, centrioles, and cilia are crucial for cellular processes.

Question 31:

Match List I with List II:
 List I                    List II 
A. Pterophyllum  I. Hag fish
B. Myxine            II. Saw fish
C. Pristis             III. Angel fish
D. Exocoetus      IV. Flying fish

Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-III, D-IV
  • (2) A-III, B-I, C-II, D-IV
  • (3) A-IV, B-I, C-II, D-III
Correct Answer:
View Solution

N/A Quick Tip: Fish species vary widely, and each has unique adaptations like flight or deep-sea living.

Question 32:

Match List I with List II:
 List I                        List II

A. Fibrous joints  I. Adjacent vertebrae, limited movement
B. Cartilaginous joints   II. Humerus and Pectoral girdle, rotational movement
C. Hinge joints   III. Skull, don’t allow any movement
D. Ball and socket joints  IV. Knee, help in locomotion
 

Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-I, B-III, C-II, D-IV
  • (3) A-II, B-III, C-I, D-IV
Correct Answer:
View Solution

N/A Quick Tip: Joints in the human body are classified based on their structure and the type of movement they allow.

Question 33:

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are true
  • (2) Both Statement I and Statement II are false
  • (3) Statement I is true but Statement II is false
Correct Answer:
View Solution

N/A Quick Tip: The hymen can tear due to activities like cycling, sports, or medical examination, not just during coitus.

Question 34:

Match List I with List II related to digestive system of cockroach.

List I & List II

A. The structures used for storing of food & I. Gizzard

B. Ring of 6-8 blind tubules at junction of foregut and midgut. & II. Gastric Caeca

C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut. & III. Malpighian tubules

D. The structures used for grinding the food. & IV. Crop

Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-I, B-II, C-III, D-IV
  • (3) A-IV, B-III, C-II, D-I
Correct Answer:
View Solution

N/A Quick Tip: In cockroaches, the crop stores food, the gastric caeca aids in digestion, the gizzard grinds food, and the Malpighian tubules are responsible for excretion and waste removal.

Question 35:

Given below are two statements:

Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.



In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both Statement I and Statement II are correct.
  • (2) Both Statement I and Statement II are incorrect.
  • (3) Statement I is correct but Statement II is incorrect.
Correct Answer:
View Solution

N/A Quick Tip: The corpus callosum is essential for the exchange of information between the two cerebral hemispheres.

Question 36:

Given below are two statements:


Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.


Statement II: Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes.


In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both Statement I and Statement II are correct.
  • (2) Both Statement I and Statement II are incorrect.
  • (3) Statement I is correct but Statement II is incorrect.
Correct Answer:
View Solution

N/A Quick Tip: Bone marrow is the site of hematopoiesis (blood cell production), while the thymus is responsible for the maturation of T-lymphocytes, essential for the adaptive immune response.

Question 37:

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:

A. Substrate enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.


Choose the correct answer from the options given below:

  • (1) E, A, D, C, B
  • (2) A, E, B, D, C
  • (3) B, A, C, D, E
Correct Answer:
View Solution

N/A Quick Tip: The enzyme catalytic cycle involves the binding of substrate, conversion into products, and release. The enzyme is reused in subsequent cycles.

Question 38:

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.


 

  • (1) FSH, Leydig cells, Sertoli cells, spermiogenesis.
  • (2) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
  • (3) FSH, Sertoli cells, Leydig cells, spermatogenesis.
Correct Answer:
View Solution

N/A Quick Tip: Spermatogenesis involves the transformation of spermatogonia into mature sperm cells through a series of stages, including spermiogenesis.

Question 39:

Match List I with List II:

List I & List II

A. Mesozoic Era & I. Lower invertebrates

B. Proterozoic Era & II. Fish \& Amphibia

C. Cenozoic Era & III. Birds \& Reptiles

D. Paleozoic Era & IV. Mammals

Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-III, D-IV
  • (2) A-III, B-I, C-II, D-IV
  • (3) A-I, B-II, C-IV, D-III
Correct Answer:
View Solution

N/A Quick Tip: The Mesozoic era is known for dinosaurs, the Cenozoic era for mammals, and the Paleozoic era for early vertebrates like fish and amphibians.

Question 40:

Match List I with List II:

List I & List II

A. Unicellular glandular epithelium & I. Salivary glands

B. Compound epithelium & II. Pancreas

C. Multicellular glandular epithelium & III. Goblet cells of alimentary canal

D. Endocrine glandular epithelium & IV. Moist surface of buccal cavity
 
Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-III, D-IV
  • (2) A-IV, B-III, C-I, D-II
  • (3) A-III, B-IV, C-I, D-II
Correct Answer:
View Solution

N/A Quick Tip: Glandular epithelium includes unicellular (e.g., goblet cells), multicellular (e.g., salivary glands), and endocrine glands that secrete hormones (e.g., pancreas).

Question 41:

Match List I with List II:

List I & List II

A. RNA polymerase III & I. snRNPs

B. Termination of transcription & II. Promotor

C. Splicing of Exons & III. Rho factor

D. TATA box & IV. SnRNAs, tRNA

Choose the correct answer from the options given below:

  • (1) A-II, B-IV, C-I, D-III
  • (2) A-III, B-II, C-IV, D-I
  • (3) A-III, B-IV, C-I, D-II
Correct Answer:
View Solution

N/A Quick Tip: RNA polymerase III is responsible for the synthesis of small RNAs such as tRNA, while the TATA box in the promoter region is essential for the initiation of transcription in eukaryotes.

Question 42:

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be

A. I^Bi/I^Ai/ii

B. I^BI^B/I^AI^A/ii

C. I^AI^B/iI^A/I^Bi

D. I^Ai/I^Bi/I^Ai


Choose the most appropriate answer from the options given below :

  • (1) A only
  • (2) B only
  • (3) C and B only
  • (4) D and E only
Correct Answer:
View Solution

N/A Quick Tip: In the ABO blood group system, O blood type is recessive, and both parents must carry the i allele to produce a child with blood group O.

Question 43:

Match List I with List II:

List I   List II

A. Exophthalmic goiter & I. Excess secretion of cortisol, moon face \& hyperglycemia.

B. Acromegaly & II. Hypo-secretion of thyroid hormone and stunted growth.

C. Cushing’s syndrome & III. Hyper secretion of thyroid hormone \& protruding eyeballs.

Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-IV, B-II, C-I, D-III
  • (3) A-III, B-IV, C-II, D-I
Correct Answer:
View Solution

N/A Quick Tip: Exophthalmic goiter, acromegaly, Cushing's syndrome, and cretinism are conditions caused by abnormal hormone secretion, each with distinct symptoms related to the over- or under-production of thyroid or growth hormones.

NEET Previous Year Question Papers with Answer Keys

NEET 2023 Question Papers NEET 2022 Question Papers NEET 2021 Question Papers
NEET 2020 Question Papers NEET 2019 Question Papers NEET 2018 Question Papers

Other UG Entrance Exams

MHT CET Previous Year Question Papers OJEE Previous Year Question Papers
TS EAMCET Previous Year Question Papers AP EAMCET Previous Year Question Papers