NEET 2024 Zoology Question Paper with Answers and Solutions PDF Q4

Match List I with List II


Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-II, B-I, C-IV, D-III
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-III, C-II, D-I

Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below:

• (1) C-E-D-A-B
• (2) E-B-D-A-C
• (3) B-D-E-A-C
• (4) E-C-A-D-B

Match List I with List II:





Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-III, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-III, B-I, C-II, D-IV
• (4) A-IV, B-II, C-III, D-I

Match List I with List II:





Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-IV, B-III, C-I, D-II
• (3) A-III, B-I, C-IV, D-II
• (4) A-II, B-IV, C-III, D-I

The flippers of the Penguins and Dolphins are an example of:

• (1) Adaptive radiation
• (2) Natural selection
• (3) Convergent evolution
• (4) Divergent evolution

Following are the stages of the pathway for conduction of an action potential through the heart:

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of the pathway from the options given below:

• (1) E-C-A-D-B
• (2) A-E-C-B-D
• (3) B-D-E-C-A
• (4) E-A-D-B-C

Which of the following statements is incorrect?

• (1) A bio-reactor provides optimal growth conditions for achieving the desired product
  (2) Most commonly used bio-reactors are of stirring type
  (3) Bio-reactors are used to produce small scale bacterial cultures
  (4) Bio-reactors have an agitator system, an oxygen delivery system, and foam control system

Which of the following is not a component of the Fallopian tube?

• (1) Uterine fundus
• (2) Isthmus
• (3) Infundibulum
• (4) Ampulla

Given below are two statements:

Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the option given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

• (1) Genetic recombination
• (2) Genetic drift
• (3) Gene migration
• (4) Constant gene pool

Which of the following is not a steroid hormone?

• (1) Cortisol
• (2) Testosterone
• (3) Progesterone
• (4) Glucagon

Match List I with List II




Choose the correct answer from the options given below:

• (1) A-III, B-I, C-II, D-IV
• (2) A-I, B-III, C-IV, D-II
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-I, C-IV, D-II

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

• (1) 5th segment
• (2) 10th segment
• (3) 8th and 9th segment
• (4) 11th segment

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-III, B-II, C-IV, D-I
• (3) A-II, B-I, C-IV, D-III
• (4) A-I, B-III, C-II, D-IV

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-II, B-III, C-I, D-IV
• (2) A-III, B-IV, C-II, D-I
• (3) A-I, B-II, C-III, D-IV
• (4) A-II, B-I, C-IV, D-III

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false

The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:

• (1) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.
• (2) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
• (3) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
• (4) Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3’ TACATGGCAAATATCCATTCA 5’

• (1) 5’ AUGUACCGUUUAUAGGUAAGU 3’
• (2) 5’ AUGUAAAGUUUAUAGGUAAGU 3’
• (3) 5’ AUGUACCGUUUAUAGGGAAGU 3’
• (4) 5’ ATGTACCGTTTATAGGTAAGT 3’

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

• (1) A, B \& D only
• (2) A, B \& E only
• (3) B, C \& E only
• (4) C, D \& E only

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-II, C-I, D-IV

Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R):

Assertion (A): FSH acts upon ovarian follicles in females and Leydig cells in males.

Reason (R): Growing ovarian follicles secrete estrogen in females while interstitial cells secrete androgen in males.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A
• (2) Both A and R are true but R is NOT the correct explanation of A
• (3) A is true but R is false
• (4) A is false but R is true

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-III, B-II, C-I, D-IV
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-I, C-III, D-II

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-IV, B-II, C-III, D-I
• (3) A-II, B-IV, C-I, D-III
• (4) A-II, B-I, C-IV, D-III

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-II, C-IV, D-III
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-III, C-II, D-I

Consider the following statements:

A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates

Choose the correct answer from the options given below:

• (1) B only
• (2) A only
• (3) C only
• (4) D only

Match List I with List II:


Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-III, B-I, C-II, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-IV, C-I, D-III

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-III, C-I, D-IV
• (4) A-III, B-I, C-IV, D-II

Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:





Name of muscle/location

• (1) (a) Smooth - Toes, (b) Skeletal – Legs, (c) Cardiac – Heart
• (2) (a) Skeletal - Triceps, (b) Smooth – Stomach, (c) Cardiac – Heart
• (3) (a) Skeletal - Biceps, (b) Involuntary – Intestine, (c) Smooth – Heart
• (4) (a) Involuntary – Nose tip, (b) Skeletal – Bone, (c) Cardiac – Heart

Match List I with List II:

• (1) A-I, B-II, C-III, D-IV
• (2) A-II, B-III, C-IV, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-I, C-II, D-III

Which of the following factors are favorable for the formation of oxyhaemoglobin in alveoli?

• (1) High pO2 and High pCO2
• (2) High pO2 and Lesser H+ concentration
• (3) Low pCO2 and High H+ concentration
• (4) Low pCO2 and High temperature

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)

A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus

Choose the correct sequence of human evolution from the options given below:

• (1) D-A-C-B
• (2) B-A-D-C
• (3) C-B-D-A
• (4) A-D-C-B

Match List I with List II:





Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-I, D-II
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-I, C-III, D-IV
• (4) A-III, B-IV, C-I, D-II

Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R):
Assertion (A): Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason (R): Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both A and R are correct and R is the correct explanation of A
• (2) Both A and R are correct but R is NOT the correct explanation of A
• (3) A is correct but R is not correct
• (4) A is not correct but R is correct

Which of the following is not a natural/traditional contraceptive method?

• (1) Coitus interruptus
• (2) Periodic abstinence
• (3) Lactational amenorrhea
• (4) Vaults

The “Ti plasmid” of Agrobacterium tumefaciens stands for

• (1) Tumour inhibiting plasmid
• (2) Tumor independent plasmid
• (3) Tumor inducing plasmid
• (4) Temperature independent plasmid

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-IV, B-II, C-I, D-III
• (3) A-III, B-IV, C-II, D-I
• (4) A-III, B-IV, C-I, D-II

Given below are two statements:
Statement I: Mitochondria and chloroplasts both are double-membrane-bound organelles.
Statement II: The inner membrane of mitochondria is relatively less permeable, as compared to chloroplasts.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Regarding the catalytic cycle of an enzyme action, select the correct sequential steps:
A. Substrate-enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to the active site.

Choose the correct answer from the options given below:

• (1) E, A, D, C, B
• (2) A, E, B, D, C
• (3) B, A, C, D, E
• (4) E, D, C, B, A

Match List I with List II related to the digestive system of a cockroach:




Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-II, C-III, D-IV
• (3) A-IV, B-III, C-II, D-I
• (4) A-III, B-II, C-IV, D-I

The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post-anal tail is absent.

Choose the most appropriate answer from the options given below:

• (1) A \& C only
• (2) A, B \& D only
• (3) B, D \& E only
• (4) B, C \& D only

Choose the correct statement given below regarding juxtamedullary nephron.

• (1) Juxtamedullary nephrons are located in the columns of Bertini.
• (2) Renal corpuscle of juxtamedullary nephron lies in the outer portion of the renal medulla.
• (3) Loop of Henle of juxtamedullary nephron runs deep into medulla.
• (4) Juxtamedullary nephrons outnumber the cortical nephrons.

Given below are two statements:
Statement I: The cerebral hemispheres are connected by a nerve tract known as the corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons, and cerebrum.

In light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-I, B-III, C-IV, D-II
• (2) A-III, B-II, C-IV, D-I
• (3) A-II, B-III, C-I, D-IV
• (4) A-IV, B-II, C-I, D-III

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-I, B-II, C-IV, D-III
• (4) A-III, B-I, C-IV, D-II

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be


A. \( I^{B}I^{A} / ii \)

B. \( I^{B}I^{B} / I^{A}I^{A} \)

C. \( I^{A}I^{B} / ii \)

D. \( I^{A}I^{B} / I^{A}I^{i} \)

E. \( ii / I^{A}I^{B} / I^{A}I^{B} \)

• (1) A only
• (2) B only
• (3) C \& B only
• (4) D \& E only

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

Given below are two statements:

Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-IV, B-III, C-I, D-II
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-I, C-IV, D-III

Match List I with List II:




Choose the correct answer from the options given below:

• (1) A-II, B-IV, C-I, D-III
• (2) A-III, B-II, C-IV, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-I, D-II

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

• (1) FSH, Leydig cells, Sertoli cells, spermiogenesis.
• (2) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
• (3) FSH, Sertoli cells, Leydig cells, spermatogenesis.
• (4) ICSH, Leydig cells, Sertoli cells, spermatogenesis.