NEET 2024 Zoology Question Paper with Answers and Solutions PDF Q5

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

Choose the correct answer from the options given below:

• (1) Both A and R are true and R is the correct explanation of A
• (2) Both A and R are true but R is NOT the correct explanation of A
• (3) A is true but R is false
• (4) A is false but R is true

Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Pons & I. & Provides additional space for Neurons, regulates posture and balance.

B. & Hypothalamus & II. & Controls respiration and gastric secretions.

C. & Medulla & III. & Connects different regions of the brain.

D. & Cerebellum & IV. & Neuro secretory cells




Choose the correct answer from the options given below:

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-IV, C-II, D-I
• (3) A-I, B-III, C-II, D-IV
• (4) A-II, B-III, C-I, D-IV

Which of the following is not a steroid hormone?

• (1) Cortisol
• (2) Testosterone
• (3) Progesterone
• (4) Glucagon

Which of the following is not a component of Fallopian tube?

• (1) Uterine fundus
• (2) Isthmus
• (3) Infundibulum
• (4) Ampulla

Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:




Choose the correct answer from the options given below:

• (1) (a) Smooth - Toes, (b) Skeletal - Legs, (c) Cardiac - Heart
• (2) (a) Skeletal - Triceps, (b) Smooth - Stomach, (c) Cardiac - Heart
• (3) (a) Skeletal - Biceps, (b) Involuntary - Intestine, (c) Smooth - Heart
• (4) (a) Involuntary - Nose tip, (b) Skeletal - Bone, (c) Cardiac - Heart

Match List I with List II:

\begin{tabular{|c|p{4cm|c|p{6cm|

List I & & List II &


A. & Expiratory capacity & I. & Expiratory reserve volume + Tidal volume + Inspiratory reserve volume

B. & Functional residual capacity & II. & Tidal volume + Expiratory reserve volume

C. & Vital capacity & III. & Tidal volume + Inspiratory reserve volume

D. & Inspiratory capacity & IV. & Expiratory reserve volume + Residual volume





Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-IV, C-I, D-III
• (4) A-III, B-II, C-IV, D-I

The flippers of the Penguins and Dolphins are the example of the:

• (1) Adaptive radiation
• (2) Natural selection
• (3) Convergent evolution
• (4) Divergent evolution

Match List I with List II:

List I & List II

\multicolumn{2{|c|{List-I & \multicolumn{2{c|{List-II


A. & Lipase & I. & Peptide bond

B. & Nuclease & II. & Ester bond

C. & Protease & III. & Glycosidic bond

D. & Amylase & IV. & Phosphodiester bond




Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-II, B-III, C-I, D-IV
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-I, C-III, D-II

The "Ti plasmid" of Agrobacterium tumefaciens stands for:

Choose the correct answer from the options given below:

• (1) Tumour inhibiting plasmid
• (2) Tumor independent plasmid
• (3) Tumor inducing plasmid
• (4) Temperature independent plasmid

Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Axoneme & I. & Centriole

B. & Cartwheel pattern & II. & Cilia and flagella

C. & Crista & III. & Chromosome

D. & Satellite & IV. & Mitochondria




Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-II, D-I
• (2) A-IV, B-II, C-III, D-I
• (3) A-II, B-IV, C-I, D-III
• (4) A-II, B-I, C-IV, D-III

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

Choose the correct answer from the options given below:

• (1) Genetic recombination
• (2) Genetic drift
• (3) Gene migration
• (4) Constant gene pool

Given below are two statements:

Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

% Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & \(\alpha\)-1 antitrypsin & I. & Cotton bollworm

B. & Cry IAb & II. & ADA deficiency

C. & Cry IAc & III. & Emphysema

D. & Enzyme replacement therapy & IV. & Corn borer




Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-III, B-II, C-I, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-II, B-IV, C-I, D-III

Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below:

• (1) C-E-D-A-B
• (2) E-B-D-A-C
• (3) B-D-E-A-C
• (4) E-C-A-D-B

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

% Choose the correct answer from the options given below:

• (1) 5th segment
• (2) 10th segment
• (3) 8th and 9th segment
• (4) 11th segment

Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Down's syndrome & I. & 11^th chromosome

B. & \(\alpha\)-Thalassemia & II. & X chromosome

C. & \(\beta\)-Thalassemia & III. & 21^st chromosome

D. & Klinefelter's syndrome & IV. & 16^th chromosome




Choose the correct answer from the options given below:

• (1) A-II, B-III, C-IV, D-I
• (2) A-II, B-IV, C-I, D-III
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-I, C-II, D-III

167. Which of the following is not a natural/traditional contraceptive method?

• (1) Coitus interruptus
• (2) Periodic abstinence
• (3) Lactational amenorrhea
• (4) Vaults

168. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Typhoid & I. & Fungus

B. & Leishmaniasis & II. & Nematode

C. & Ringworm & III. & Protozoa

D. & Filariasis & IV. & Bacteria




Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-IV, B-III, C-I, D-II
• (3) A-III, B-I, C-IV, D-II
• (4) A-II, B-IV, C-III, D-I

169. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Pleurobrachia & I. & Mollusca

B. & Radula & II. & Ctenophora

C. & Stomochord & III. & Osteichthyes

D. & Air bladder & IV. & Hemichordata




Choose the correct answer from the options given below :

• (1) A-IV, B-II, C-III, D-I
• (2) A-II, B-I, C-IV, D-III
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-III, C-II, D-I

170. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Common cold & I. & Plasmodium

B. & Haemozoin & II. & Typhoid

C. & Widal test & III. & Rhinoviruses

D. & Allergy & IV. & Dust mites




Choose the correct answer from the options given below :

• (1) A-II, B-IV, C-III, D-I
• (2) A-II, B-III, C-II, D-IV
• (3) A-III, B-I, C-II, D-IV
• (4) A-IV, B-II, C-III, D-I

171. The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of 'X' and 'Y' genes:

• (1) The gene 'X' is responsible for resistance to antibiotics and 'Y' for protein involved in the replication of Plasmid.
• (2) The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid.
• (3) The gene 'X' is for protein involved in replication of Plasmid and 'Y' for resistance to antibiotics.
• (4) Gene 'X' is responsible for recognitions sites and 'Y' is responsible for antibiotic resistance.

172. Given below are two statements:


Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below :

• (1) Both Statement I and Statement II are true
• (2) Both Statement I and Statement II are false
• (3) Statement I is true but Statement II is false
• (4) Statement I is false but Statement II is true

173. Following are the stages of pathway for conduction of an action potential through the heart:

% List of Stages
A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of pathway from the options given below

• (1) E-C-A-D-B
• (2) A-E-C-B-D
• (3) B-D-E-C-A
• (4) E-A-D-B-C

174. Given below are some stages of human evolution. Arrange them in correct sequence (Past to Recent):

% List of Stages
A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus

Choose the correct sequence of human evolution from the options given below:

• (1) D-A-C-B
• (2) B-A-D-C
• (3) C-B-D-A
• (4) A-D-C-B

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

• (1) Low pCO\(_2\) and High H\(^+\) concentration
• (2) Low pCO\(_2\) and High temperature
• (3) High pO\(_2\) and High pCO\(_2\)
• (4) High pO\(_2\) and Lesser H\(^+\) concentration

176. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I (Sub Phases of Prophase I) & \multicolumn{2{c|{List II (Specific Characters)


A. & Diakinesis & I. & Synaptonemal complex formation

B. & Pachytene & II. & Completion of terminalisation of chiasmata

C. & Zygotene & III. & Chromosomes look like thin threads

D. & Leptotene & IV. & Appearance of recombination nodules




Choose the correct answer from the options given below

• (1) A-IV, B-II, C-I, D-III
• (2) A-I, B-II, C-IV, D-III
• (3) A-II, B-IV, C-I, D-III
• (4) A-IV, B-III, C-II, D-I

177. Which of the following statements is incorrect?

• (A) A bio-reactor provides optimal growth conditions for achieving the desired product.
• (B) Most commonly used bio-reactors are of stirring type.
• (C) Bio-reactors are used to produce small scale bacterial cultures.
• (D) Bio-reactors have an agitator system, an oxygen delivery system, and foam control system.

178. Consider the following statements:


A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates

Choose the correct answer from the options given below :

• (1) B only
• (2) A only
• (3) C only
• (4) D only

179. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Non-medicated IUD & I. & Multiload 375

B. & Copper releasing IUD & II. & Progestogens

C. & Hormone releasing IUD & III. & Lippes loop

D. & Implants & IV. & LNG-20




Choose the correct answer from the option given below:

• (1) A-III, B-I, C-IV, D-II
• (2) A-I, B-III, C-IV, D-II
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-I, C-IV, D-II

180. Which one is the correct product of DNA dependent RNA polymerase to the given template?

% DNA Template
DNA Template: 3'TACATGGCAAATATCCATTCA5'

• (1) 5'AUGUACCGUUUAAUGGUUAAG3'
• (2) 5'AUUGUAAAGUUUAUGGUAAGU3'
• (3) 5'AUUGUACCGUUUAAUGGGAAGU3'
• (4) 5'ATGTACCGTTTATAGGTAAGT3'

181. Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

% Assertion and Reason
Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

• (1) Both A and R are correct and R is the correct explanation of A
• (2) Both A and R are correct but R is NOT the correct explanation of A
• (3) A is correct but R is not correct
• (4) A is not correct but R is correct

182. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Fibrous joints & I. & Adjacent vertebrae, limited movement

B. & Cartilaginous joints & II. & Humerus and Pectoral girdle, rotational movement

C. & Hinge joints & III. & Skull, don't allow any movement

D. & Ball and socket joints & IV. & Knee, help in locomotion




Choose the correct answer from the options given below :

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-III, C-I, D-IV
• (4) A-III, B-I, C-IV, D-II

183. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Pterophyllum & I. & Hag fish

B. & Myxine & II. & Saw fish

C. & Pristis & III. & Angel fish

D. & Exocoetus & IV. & Flying fish




Choose the correct answer from the options given below :

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-IV, B-I, C-II, D-III
• (4) A-III, B-II, C-I, D-IV

184. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Cocaine & I. & Effective sedative in surgery

B. & Heroin & II. & Cannabis sativa

C. & Morphine & III. & Erythroxylum

D. & Marijuana & IV. & Papaver somniferum




Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-I, D-II
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-I, C-III, D-IV
• (4) A-III, B-IV, C-I, D-II

185. Which of the following are Autoimmune disorders?


A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the correct answer from the options given below:

• (1) A, B \& D only
• (2) A, B \& E only
• (3) B, C \& E only
• (4) C, D \& E only

186. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Exophthalmic goiter & I. & Excess secretion of cortisol, moon face \& hyperglycemia.

B. & Acromegaly & II. & Hypo-secretion of thyroid hormone and stunted growth.

C. & Cushing's syndrome & III. & Hyper secretion of thyroid hormone \& protruding eye balls.

D. & Cretinism & IV. & Excessive secretion of growth hormone.




Choose the correct answer from the options given below :

• (1) A-I, B-III, C-II, D-IV
• (2) A-IV, B-II, C-I, D-III
• (3) A-III, B-IV, C-II, D-I
• (4) A-III, B-IV, C-I, D-II

187. Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis:

• (1) FSH, Leydig cells, Sertoli cells, spermiogenesis.
• (2) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
• (3) FSH, Sertoli cells, Leydig cells, spermatogenesis.
• (4) ICSH, Leydig cells, Sertoli cells, spermatogenesis.

188. Given below are two statements:


Statement I: Mitochondria and chloroplasts both have double membranes bound organelles.

Statement II: The inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

189. Given below are two statements:


Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

190. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & RNA polymerase III & I. & snRNPs

B. & Termination of transcription & II. & Promotor

C. & Splicing of Exons & III. & Rho factor

D. & TATA box & IV. & SnRNAs, tRNA




Choose the correct answer from the options given below :

• (1) A-II, B-IV, C-I, D-III
• (2) A-III, B-II, C-IV, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-I, D-II

191. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Mesozoic Era & I. & Lower invertebrates

B. & Proterozoic Era & II. & Fish \& Amphibia

C. & Cenozoic Era & III. & Birds \& Reptiles

D. & Paleozoic Era & IV. & Mammals




Choose the correct answer from the options given below :

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-I, B-II, C-IV, D-III
• (4) A-III, B-I, C-IV, D-II

192. As per ABO blood grouping system, the blood group of father is B\(^+\), mother is A\(^+\) and child is O\(^+\). Their respective genotype can be:

% Genotypes

\(|B^i|/|A^i|/ii\)
\(|B|B|/|A|A|/ii\)
\(|A|B/|iA|/|B^i|\)
\(|A^i|/|B^i|/|A^i|\)
\(i|B^i|/|A|/|A|B\)


Choose the most appropriate answer from the options given below :

• (1) A only
• (2) B only
• (3) C \& B only
• (4) D \& E only

193. Match List I with List II related to the digestive system of a cockroach:

\begin{tabular{|c|p{10cm|c|l|

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & The structures used for storing of food & I. & Gizzard

B. & Ring of 6-8 blind tubules at junction of foregut and midgut & II. & Gastric Caeca

C. & Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut & III. & Malpighian tubules

D. & The structures used for grinding the food. & IV. & Crop




Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-I, B-II, C-III, D-IV
• (3) A-IV, B-III, C-II, D-I
• (4) A-III, B-II, C-IV, D-I

194. Regarding catalytic cycle of an enzyme action, select the correct sequential steps:


A. Substrate enzyme complex formation

B. Free enzyme ready to bind with another substrate

C. Release of products

D. Chemical bonds of the substrate broken

E. Substrate binding to active site

• (1) E, A, D, C, B
• (2) A, E, B, D, C
• (3) B, A, C, D, E
• (4) E, D, C, B, A

195. The following are the statements about non-chordates:


A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

• (1) A \& C only
• (2) A, B \& D only
• (3) B, D \& E only
• (4) B, C \& D only

196. Given below are two statements:


Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.

• (1) Both Statement I and Statement II are correct.
• (2) Both Statement I and Statement II are incorrect.
• (3) Statement I is correct but Statement II is incorrect.
• (4) Statement I is incorrect but Statement II is correct.

197. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & P wave & I. & Heart muscles are electrically silent.

B. & QRS complex & II. & Depolarisation of ventricles.

C. & T wave & III. & Depolarisation of atria.

D. & T-P gap & IV. & Repolarisation of ventricles.




Choose the correct answer from the options given below :

• (1) A-I, B-III, C-IV, D-II
• (2) A-III, B-II, C-IV, D-I
• (3) A-II, B-III, C-I, D-IV
• (4) A-IV, B-II, C-I, D-III

198. Given below are two statements:


Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.


In the light of the above statements, choose the correct answer from the options given below :

• (1) Both Statement I and Statement II are true.
• (2) Both Statement I and Statement II are false.
• (3) Statement I is true but Statement II is false.
• (4) Statement I is false but Statement II is true.

199. Choose the correct statement given below regarding juxta medullary nephron.

• (1) Juxta medullary nephrons are located in the columns of Bertini.
• (2) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
• (3) Loop of Henle of juxta medullary nephron runs deep into medulla.
• (4) Juxta medullary nephrons outnumber the cortical nephrons.

200. Match List I with List II:

List I & List II

\multicolumn{2{|c|{List I & \multicolumn{2{c|{List II


A. & Unicellular glandular epithelium & I. & Salivary glands

B. & Compound epithelium & II. & Pancreas

C. & Multicellular glandular epithelium & III. & Goblet cells of alimentary canal

D. & Endocrine glandular epithelium & IV. & Moist surface of buccal cavity




Choose the correct answer from the options given below:

• (1) A-I, B-III, C-IV, D-II
• (2) A-III, B-II, C-I, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-II, C-I, D-III