NEET 2024 Zoology Question Paper with Answers and Solutions PDF R3

Which of the following is not a natural/traditional contraceptive method?

• (1) Periodic abstinence
• (2) Lactational amenorrhea
• (3) Vaults
• (4) Coitus interruptus

Match List I with List II 

List-I & List-II
A. Common cold & I. Plasmodium
B. Haemozoin & II. Typhoid
C. Widal test & III. Rhinoviruses
D. Allergy & IV. Dust mites

• (1) A-I, B-III, C-II, D-IV
• (2) A-III, B-I, C-II, D-IV
• (3) A-IV, B-II, C-III, D-I
• (4) A-II, B-IV, C-III, D-I

Which of the following statements is incorrect?

• (1) Most commonly used bio-reactors are of stirring type
• (2) Bio-reactors are used to produce small scale bacterial cultures
• (3) Bio-reactors have an agitator system, an oxygen delivery system and foam control system
• (4) A bio-reactor provides optimal growth conditions for achieving the desired product

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the correct answer from the options given below:

• (1) A, B and E only
• (2) B, C and E only
• (3) C, D and E only
• (4) A, B and D only

Match List I with List II 

List-I & List-II
A. Down’s syndrome & I. 11th chromosome
B. Alpha-Thalassemia & II. ‘X’ chromosome
C. Beta-Thalassemia & III. 21st chromosome
D. Klinefelter’s syndrome & IV. 16th chromosome

Choose the correct answer from the options given below:

• (1) A-II, B-III, C-IV, D-I
• (2) A-III, B-IV, C-I, D-II
• (3) A-IV, B-I, C-II, D-III
• (4) A-I, B-II, C-III, D-IV

Match List I with List II

List-I (Type of IUD) & List-II (Example)
A. Non-medicated IUD & I. Multiload 375
B. Copper releasing IUD & III. Lippes loop
C. Hormone releasing IUD & IV. LNG-20
D. Implants & II. Progestogens

Choose the correct answer from the options given below:

• (1) A-I, B-III, C-IV, D-II
• (2) A-IV, B-I, C-II, D-III
• (3) A-III, B-I, C-IV, D-II
• (4) A-III, B-I, C-II, D-IV

Match List I with List II 

List-I & List-II
A. Pleurobrachia & I. Mollusca
B. Radula & II. Ctenophora
C. Stomochord & III. Osteichthyes
D. Air bladder & IV. Hemichordata

Choose the correct answer from the options given below:

• (1) A-II, B-I, C-IV, D-III
• (2) A-II, B-IV, C-I, D-III
• (3) A-IV, B-III, C-II, D-I
• (4) A-IV, B-II, C-III, D-I

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

• (1) High pO2 and Lesser H+ concentration
• (2) Low pCO2 and High H+ concentration
• (3) Low pCO2 and High temperature
• (4) High pO2 and High pCO2

Match List I with List II

List-I & List-II
A. Cocaine & I. Effective sedative in surgery
B. Heroin & II. Cannabis sativa
C. Morphine & III. Erythroxylum
D. Marijuana & IV. Papaver somniferum

Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-II, B-I, C-III, D-IV
• (3) A-III, B-IV, C-I, D-II
• (4) A-IV, B-III, C-I, D-II

Match List I with List II

List-I (Sub Phases of Prophase I) & List-II (Specific Characters)
A. Diakinesis & I. Synaptonemal complex formation
B. Pachytene & II. Completion of terminalisation of chiasmata
C. Zygotene & III. Chromosomes look like thin threads
D. Leptotene & IV. Appearance of recombination nodules

Choose the correct answer from the options given below:

• (1) A-I, B-II, C-IV, D-III
• (2) A-II, B-IV, C-I, D-III
• (3) A-IV, B-III, C-II, D-I
• (4) A-IV, B-II, C-III, D-I

Match List I with List II 

List-I & List-II
A. Fibrous joints & I. Adjacent vertebrae, limited movement
B. Cartilaginous joints & II. Humerus and Pectoral girdle, rotational movement
C. Hinge joints & III. Skull, don’t allow any movement
D. Ball and socket joints & IV. Knee, help in locomotion

Choose the correct answer from the options given below:

• (1) A-I, B-III, C-II, D-IV
• (2) A-II, B-III, C-I, D-IV
• (3) A-III, B-I, C-IV, D-II
• (4) A-IV, B-II, C-III, D-I

Which of the following is not a steroid hormone?

• (1) Testosterone
• (2) Progesterone
• (3) Glucagon
• (4) Cortisol

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

• (1) 10th segment
• (2) 8th and 9th segment
• (3) 11th segment
• (4) 5th segment

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

Choose the correct answer from the options given below:

• (1) Both A and R are true but R is NOT the correct explanation of A
• (2) A is true but R is false
• (3) A is false but R is true
• (4) Both A and R are true and R is the correct explanation of A

Match List I with List II 

List-I (Pulmonary Volumes) & List-II (Corresponding Volumes)
A. Expiratory capacity & I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
B. Functional residual capacity & II. Tidal volume + Expiratory reserve volume
C. Vital capacity & III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity & IV. Expiratory reserve volume + Residual volume

Choose the correct answer from the options given below:

• (1) A-III, B-II, C-IV, D-I
• (2) A-II, B-I, C-IV, D-III
• (3) A-I, B-III, C-II, D-IV
• (4) A-II, B-IV, C-I, D-III

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

• (1) (a) Skeletal - Triceps
  (b) Smooth – Stomach
  (c) Cardiac – Heart
• (2) (a) Skeletal - Biceps
  (b) Involuntary – Intestine
  (c) Smooth – Heart
• (3) (a) Involuntary – Nose tip
  (b) Skeletal – Bone
  (c) Cardiac – Heart
• (4) (a) Smooth - Toes
  (b) Skeletal – Legs
  (c) Cardiac – Heart

Match List I with List II 

List-I & List-II
A. Lipase & I. Peptide bond
B. Nuclease & II. Ester bond
C. Protease & III. Glycosidic bond
D. Amylase & IV. Phosphodiester bond
Choose the correct answer from the options given below:

• (1) A-III, B-II, C-I, D-IV
• (2) A-II, B-IV, C-I, D-III
• (3) A-IV, B-I, C-III, D-II
• (4) A-IV, B-II, C-III, D-I

The flippers of the Penguins and Dolphins are the example of the

• (1) Natural selection
• (2) Convergent evolution
• (3) Divergent evolution
• (4) Adaptive radiation

Following are the stages of cell division :

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase


Choose the correct answer from the options given below:

• (1) E-B-D-A-C
• (2) B-D-E-A-C
• (3) E-C-A-D-B
• (4) C-E-D-A-B

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

• (1) Genetic drift
• (2) Gene migration
• (3) Constant gene pool
• (4) Genetic recombination

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

• (1) Both A and R are true but R is NOT the correct explanation of A
• (2) A is true but R is false
• (3) A is false but R is true
• (4) Both A and R are true and R is the correct explanation of A

Match List I with List II 

List-I & List-II
A. Typhoid & I. Fungus
B. Leishmaniasis & II. Nematode
C. Ringworm & III. Protozoa
D. Filariasis & IV. Bacteria

Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-I, D-II
• (2) A-III, B-I, C-IV, D-II
• (3) A-II, B-IV, C-III, D-I
• (4) A-I, B-III, C-II, D-IV

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus


Choose the correct answer from the options given below:

• (1) B-A-D-C
• (2) C-B-D-A
• (3) A-D-C-B
• (4) D-A-C-B

Which of the following is not a component of Fallopian tube?

• (1) Isthmus
• (2) Infundibulum
• (3) Ampulla
• (4) Uterine fundus

Consider the following statements:

A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates


Choose the correct answer from the options given below:

• (1) A only
• (2) C only
• (3) D only
• (4) B only

Match List I with List II 

List-I & List-II
A. Axoneme & I. Centriole
B. Cartwheel pattern & II. Cilia and flagella
C. Crista & III. Chromosome
D. Satellite & IV. Mitochondria

Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-III, D-I
• (2) A-II, B-IV, C-I, D-III
• (3) A-II, B-I, C-IV, D-III
• (4) A-IV, B-III, C-II, D-I

Match List I with List II 

List I & List II
A. Pterophyllum & I. Hag fish
B. Myxine & II. Saw fish
C. Pristis & III. Angel fish
D. Exocoetus & IV. Flying fish

Choose the correct answer from the options given below:

• (1) A-III, B-I, C-II, D-IV
• (2) A-IV, B-I, C-II, D-III
• (3) A-III, B-II, C-I, D-IV
• (4) A-II, B-I, C-III, D-IV

Match List I with List II

List-I & List-II
A. Pons & I. Provides additional space for Neurons, regulates posture and balance.
B. Hypothalamus & II. Controls respiration and gastric secretions.
C. Medulla & III. Connects different regions of the brain.
D. Cerebellum & IV. Neuro secretory cells

Choose the correct answer from the options given below:

• (1) A-III, B-IV, C-II, D-I
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-I, C-III, D-IV
• (4) A-II, B-III, C-I, D-IV

The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes :

• (1) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
• (2) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
• (3) Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.
• (4) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.

Given below are two statements :

Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are false
• (2) Statement I is true but Statement II is false
• (3) Statement I is false but Statement II is true
• (4) Both Statement I and Statement II are true

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

Choose the correct answer from the options given below:

• (1) Both A and R are correct but R is NOT the correct explanation of A
• (2) A is correct but R is not correct
• (3) A is not correct but R is correct
• (4) Both A and R are correct and R is the correct explanation of A

Following are the stages of pathway for conduction of an action potential through the heart:

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct answer from the options given below:

• (1) A-E-C-B-D
• (2) B-D-E-C-A
• (3) E-A-D-B-C
• (4) E-C-A-D-B

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3’TACATGGCAAATATCCATTCA5’

• (1) 5’AUGUAAAGUUUAUAGGUAAGU3’
• (2) 5’AUGUACCGUUUAUAGGGAAGU3’
• (3) 5’ATGTACCGTTTATAGGTAAGT3’
• (4) 5’AUGUACCGUUUAUAGGUAAGU3’

Match List I with List II 

List I & List II
A. –I antitrypsin & I. Cotton bollworm
B. Cry IAb & II. ADA deficiency
C. Cry IAc & III. Emphysema
D. Enzyme replacement therapy & IV. Corn borer

Choose the correct answer from the options given below:

• (1) A-III, B-I, C-II, D-IV
• (2) A-III, B-IV, C-I, D-II
• (3) A-II, B-IV, C-I, D-III
• (4) A-II, B-I, C-IV, D-III

The “Ti plasmid” of Agrobacterium tumefaciens stands for

• (1) Tumor independent plasmid
• (2) Tumor inducing plasmid
• (3) Temperature independent plasmid
• (4) Tumour inhibiting plasmid

Match List I with List II 

List-I & List-II
A. P wave & I. Heart muscles are electrically silent.
B. QRS complex & II. Depolarisation of ventricles.
C. T wave & III. Depolarisation of atria.
D. T-P gap & IV. Repolarisation of ventricles.

Choose the correct answer from the options given below:

• (1) A-III, B-II, C-IV, D-I
• (2) A-II, B-III, C-I, D-IV
• (3) A-IV, B-II, C-I, D-III
• (4) A-I, B-III, C-IV, D-II

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.


Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are false.
• (2) Statement I is true but Statement II is false.
• (3) Statement I is false but Statement II is true.
• (4) Both Statement I and Statement II are true.

Given below are two statements:

Statement I: Mitochondria and chloroplasts both double membranes bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.


Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are incorrect.
• (2) Statement I is correct but Statement II is incorrect.
• (3) Statement I is incorrect but Statement II is correct.
• (4) Both Statement I and Statement II are correct.

Choose the correct statement given below regarding juxta medullary nephron.

• (1) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
• (2) Loop of Henle of juxta medullary nephron runs deep into medulla.
• (3) Juxta medullary nephrons outnumber the cortical nephrons.
• (4) Juxta medullary nephrons are located in the columns of Bertini.

Match List I with List II 

List-I & List-II
A. Exophthalmic goiter & I. Excess secretion of cortisol, moon face \& hyperglycemia.
B. Acromegaly & II. Hypo-secretion of thyroid hormone and stunted growth.
C. Cushing’s syndrome & III. Hyper secretion of thyroid hormone \& protruding eyeballs.
D. Cretinism & IV. Excessive secretion of growth hormone.

Choose the correct answer from the options given below:

• (1) A-IV, B-II, C-I, D-III
• (2) A-III, B-IV, C-II, D-I
• (3) A-III, B-IV, C-I, D-II
• (4) A-I, B-III, C-II, D-IV

Match List I with List II 

List-I & List-II
A. Unicellular glandular epithelium & I. Salivary glands
B. Compound epithelium & II. Pancreas
C. Multicellular glandular epithelium & III. Goblet cells of alimentary canal
D. Endocrine glandular epithelium & IV. Moist surface of buccal cavity

Choose the correct answer from the options given below:

• (1) A-IV, B-III, C-I, D-II
• (2) A-III, B-IV, C-I, D-II
• (3) A-II, B-I, C-IV, D-III
• (4) A-II, B-I, C-III, D-IV

Match List I with List II 

List I & List II
A. RNA polymerase III & I. snRNPs
B. Termination of transcription & II. Promotor
C. Splicing of Exons & III. Rho factor
D. TATA box & IV. SnRNAs, tRNA

Choose the correct answer from the options given below:

• (1) A-III, B-II, C-IV, D-I
• (2) A-III, B-IV, C-I, D-II
• (3) A-IV, B-III, C-I, D-II
• (4) A-II, B-IV, C-I, D-III

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

• (1) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
• (2) FSH, Sertoli cells, Leydig cells, spermatogenesis.
• (3) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
• (4) FSH, Leydig cells, Sertoli cells, spermiogenesis.

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:

A. Substrate enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.

Choose the correct answer from the options given below:

• (1) A, E, B, D, C
• (2) B, A, C, D, E
• (3) E, D, C, B, A
• (4) E, A, D, C, B

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

Choose the correct answer from the options given below:

• (1) A, B and D only
• (2) B, D and E only
• (3) B, C and D only
• (4) A and C only

Match List I with List II related to digestive system of cockroach. 

List I & List II
A. Structures for storing of food & I. Gizzard
B. Ring: 6-8 blind tubules at junction of foregut and midgut. & II. Gastric Caeca
C. Ring: 100-150 yellow filaments at junction of midgut and hindgut. & III. Malpighian tubules
D. Structures for grinding the food. & IV. Crop

Choose the correct answer from the options given below:

• (1) A-I, B-II, C-III, D-IV
• (2) A-IV, B-III, C-II, D-I
• (3) A-III, B-II, C-IV, D-I
• (4) A-IV, B-II, C-III, D-I

Given below are two statements:

Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.


Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are incorrect.
• (2) Statement I is correct but Statement II is incorrect.
• (3) Statement I is incorrect but Statement II is correct.
• (4) Both Statement I and Statement II are correct.

Match List I with List II 

List I & List II
A. Mesozoic Era & I. Lower invertebrates
B. Proterozoic Era & II. Fish \& Amphibia
C. Cenozoic Era & III. Birds \& Reptiles
D. Paleozoic Era & IV. Mammals

Choose the correct answer from the options given below:

• (1) A-III, B-I, C-II, D-IV
• (2) A-I, B-II, C-IV, D-III
• (3) A-III, B-I, C-IV, D-II
• (4) A-II, B-I, C-III, D-IV

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:

• (1) B only
• (2) C \& B only
• (3) D \& E only
• (4) A only

Given below are two statements:

Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes.

Choose the correct answer from the options given below:

• (1) Both Statement I and Statement II are incorrect.
• (2) Statement I is correct but Statement II is incorrect.
• (3) Statement I is incorrect but Statement II is correct.
• (4) Both Statement I and Statement II are correct.