NEET 2024 Zoology Question Paper with Answers and Solutions PDF S1

The formation of oxyhaemoglobin is favoured in conditions of high pO\textsubscript{2 and low H\textsuperscript{+ concentration, as it enhances oxygen binding to hemoglobin.

% Correct Answer
Correct Answer: (3) High pO\textsubscript{2 and Lesser H\textsuperscript{+ concentration
Quick Tip: Oxyhaemoglobin forms more efficiently when pO\textsubscript{2} is high (as in alveoli) and pCO\textsubscript{2} is low, favoring oxygen binding.

The correct sequence of stages in cell division is:
- Gap 1 phase (E)
- Synthesis phase (C)
- Gap 2 phase (A)
- Karyokinesis (D)
- Cytokinesis (B)

% Correct Answer
Correct Answer: (1) E-C-A-D-B
Quick Tip: Cell division follows a specific sequence: G1, S, G2, mitosis (karyokinesis), and cytokinesis.

The anal cerci in cockroaches are present on the 10th segment.

% Correct Answer
Correct Answer: (3) 10^th segment
Quick Tip: - The anal cerci are sensory organs found on the 10th abdominal segment of both male and female cockroaches.

The correct matching is:
- A. Pleurobrachia \(\rightarrow\) II. Ctenophora
- B. Radula \(\rightarrow\) I. Mollusca
- C. Stomochord \(\rightarrow\) IV. Hemichordata
- D. Air bladder \(\rightarrow\) III. Osteichthyes

% Correct Answer
Correct Answer: (3) A-II, B-I, C-IV, D-III
Quick Tip: - Pleurobrachia is a genus of Ctenophora (comb jellies). - Radula is a characteristic of molluscs. - Stomochord is a structure found in hemichordates. - Air bladder is a feature of osteichthyes (bony fish).

(a) Skeletal - Triceps
(b) Smooth - Stomach
(c) Cardiac - Heart


Correct Answer: (3) A-III, B-II, C-I, D-III Quick Tip: \textbf{Quick Tip:} Understanding the differences in the structure and location of various muscle types—skeletal, smooth, and cardiac—helps in identifying them accurately.

N/A

N/A

N/A

N/A

N/A

Step 1: {Understanding Natural Contraceptive Methods

- Natural contraception relies on the body's biological functions without external interventions.
- Coitus interruptus (withdrawal), periodic abstinence, and lactational amenorrhea are natural methods.

Step 2: {Identify the Incorrect Option

- Vaults are **barrier methods** (diaphragms or caps) placed inside the female reproductive tract, making them **non-natural** contraception.

Step 3: {Conclusion

Since Vaults involve artificial means, the correct answer is **(A) Vaults**. Quick Tip: Natural contraception includes behavioral and physiological methods like abstinence, withdrawal, and fertility awareness.

Step 1: {Identify the Organisms

- **Pterophyllum** (Angelfish) → (III) Angel Fish

- **Myxine** (Hagfish) → (I) Hag Fish

- **Pristis** (Sawfish) → (II) Saw Fish

- **Exocoetus** (Flying Fish) → (IV) Flying Fish


Step 2: {Match List I with List II
\[ \begin{array}{|c|c|} \hline \textbf{List I} & \textbf{List II}
\hline Pterophyllum & Angel Fish (III)
Myxine & Hag Fish (I)
Pristis & Saw Fish (II)
Exocoetus & Flying Fish (IV)
\hline \end{array} \]

Step 3: {Conclusion

Thus, the correct matching is **(C) A-III, B-I, C-II, D-IV**. Quick Tip: Taxonomic classification helps in understanding fish diversity, including their evolutionary adaptations.

Step 1: {Understanding Evolutionary Concepts

- **Divergent Evolution**: Organisms share a common ancestor but develop different structures over time.
- **Convergent Evolution**: Different species develop similar structures due to similar environmental pressures.
- **Adaptive Radiation**: Rapid diversification from a common ancestor.
- **Natural Selection**: Survival and reproduction based on advantageous traits.

Step 2: {Identifying the Correct Type of Evolution

- **Penguins (Birds) and Dolphins (Mammals)** evolved flippers independently due to **aquatic adaptation**.
- This is an example of **convergent evolution**, as their flippers serve similar functions but originate from different ancestral structures.

Step 3: {Conclusion

Thus, the correct answer is **(D) Convergent Evolution**. Quick Tip: Convergent evolution occurs when unrelated species develop similar traits due to environmental adaptation.

Step 1: {Classify Steroid Hormones

Steroid hormones are derived from cholesterol and include hormones like cortisol, testosterone, and progesterone.

Step 2: {Identify the Non-Steroid Hormone

Glucagon is a **peptide hormone** produced by the pancreas, not a steroid hormone.

Step 3: {Conclusion

Thus, the correct answer is **(A) Glucagon**. Quick Tip: Steroid hormones include cortisol, testosterone, and progesterone, while glucagon is a peptide hormone.

Step 1: {Identify the Chromosomal Abnormalities

- **Down’s syndrome** is caused by trisomy of chromosome 21.
- **\(\alpha\)-Thalassemia** is associated with deletions on chromosome 16.
- **\(\beta\)-Thalassemia** is linked to mutations on chromosome 11.
- **Klinefelter’s syndrome** is caused by the presence of an extra X chromosome (XXY).

Step 2: {Match the Correct Chromosomes

- A-III: Down’s syndrome → 21\(^st\) chromosome.
- B-IV: \(\alpha\)-Thalassemia → 16\(^th\) chromosome.
- C-I: \(\beta\)-Thalassemia → 11\(^th\) chromosome.
- D-II: Klinefelter’s syndrome → X chromosome.

Step 3: {Conclusion

Thus, the correct matching is **(4) A-III, B-IV, C-I, D-II**. Quick Tip: Down’s syndrome is caused by trisomy of chromosome 21, while Klinefelter’s syndrome is caused by the presence of an extra X chromosome.

Step 1: {Evaluate Assertion A

Breast-feeding during the initial period is recommended by doctors because of its nutritional value and its ability to provide immunity.

Step 2: {Evaluate Reason R

Colostrum, the first milk produced by the mother, contains essential antibodies that help the infant to develop immunity and resistance to infections.

Step 3: {Conclusion

Since both Assertion A and Reason R are correct, and Reason R explains why breast-feeding is beneficial, the correct answer is **(2) Both A and R are correct and R is the correct explanation of A**. Quick Tip: Breast-feeding provides not just nutrition but also vital antibodies from colostrum to build the infant’s immunity.

Step 1: {Understand Respiratory Capacities

- **Expiratory capacity** is the sum of **expiratory reserve volume** and **tidal volume**, and includes the volume of air a person can forcefully exhale after normal exhalation.
- **Functional residual capacity** is the sum of **residual volume** and **expiratory reserve volume**, representing the volume of air remaining in the lungs after normal exhalation.
- **Vital capacity** is the sum of **tidal volume**, **inspiratory reserve volume**, and **expiratory reserve volume**, representing the maximum volume of air a person can exhale after taking a deep breath.
- **Inspiratory capacity** is the sum of **tidal volume** and **inspiratory reserve volume**, representing the maximum volume of air a person can inhale after normal inhalation.

Step 2: {Match the Lists

- A-I: Expiratory capacity → Expiratory reserve volume + Tidal volume + Inspiratory reserve volume.
- B-III: Functional residual capacity → Expiratory reserve volume + Residual volume.
- C-II: Vital capacity → Tidal volume + Expiratory reserve volume.
- D-IV: Inspiratory capacity → Tidal volume + Inspiratory reserve volume.

Step 3: {Conclusion

Thus, the correct matching is **(2) A-I, B-III, C-II, D-IV**. Quick Tip: Vital capacity is one of the key measures of lung function, indicating the maximum amount of air a person can exhale after inhaling deeply.

Step 1: {Match the Sub Phases and Specific Characteristics

- **Diakinesis** → Completion of terminalisation of chiasmata (A-II).
- **Pachytene** → Appearance of recombination nodules (B-IV).
- **Zygotene** → Synaptonemal complex formation (C-I).
- **Leptotene** → Chromosomes look like thin threads (D-III).

Step 2: {Conclusion

Thus, the correct matching is **(4) A-II, B-IV, C-I, D-III**. Quick Tip: During prophase I of meiosis, chromosomes undergo synapsis and recombination to ensure genetic diversity.

Step 1: {Evaluate Assertion A

FSH (Follicle Stimulating Hormone) stimulates the development of ovarian follicles in females and the Leydig cells in males.

Step 2: {Evaluate Reason R

Growing ovarian follicles indeed secrete estrogen, and interstitial cells (Leydig cells) secrete androgen in males.

Step 3: {Conclusion

Both Assertion A and Reason R are correct, and Reason R explains why FSH is involved in hormone secretion in both males and females. Thus, the correct answer is **(2) Both A and R are correct and R is the correct explanation of A**. Quick Tip: FSH plays a crucial role in regulating reproductive functions in both males and females by acting on the gonads.

Step 1: {Evaluate Statement I

The presence or absence of hymen is not a reliable indicator of virginity because it can be affected by several non-sexual factors such as physical activity, injury, or medical procedures.

Step 2: {Evaluate Statement II

Female genital mutilation (FGM) is a harmful practice that involves the partial or complete removal or alteration of female genitalia for non-medical reasons, usually as part of certain cultural practices.

Step 3: {Conclusion

Both statements are true. Therefore, the correct answer is **(B) Both Statement I and Statement II are true**. Quick Tip: FGM is a human rights violation, and it is crucial to raise awareness about its dangers and the importance of protecting girls and women from this practice.

- **Myasthenia gravis** is an autoimmune disorder in which the immune system attacks the communication between nerves and muscles.
- **Rheumatoid arthritis** is an autoimmune disorder that causes chronic inflammation in the joints.
- **Gout** is not an autoimmune disorder; it is caused by the buildup of uric acid crystals in the joints.
- **Muscular dystrophy** is a genetic disorder that affects muscle strength and function, but it is not autoimmune.
- **Systemic Lupus Erythematosus (SLE)** is an autoimmune disease where the immune system attacks various parts of the body, including the skin, joints, and organs.

Thus, the correct answer is **(3) A, B & E only**. Quick Tip: Autoimmune disorders occur when the body's immune system mistakenly attacks its own tissues, and they can affect various body parts including joints, muscles, and organs.

Step 1: {Evaluate each statement


- **Annelids** are true coelomates because they possess a well-developed body cavity lined by mesoderm. (**True**)
- **Poriferans** (sponges) are not pseudocoelomates; they lack a body cavity entirely. (**False**)
- **Aschelminthes** (Nematodes) are not acoelomates; they are pseudocoelomates, meaning they have a body cavity but it is not lined by mesoderm. (**False**)
- **Platyhelminthes** (flatworms) are acoelomates, meaning they lack a body cavity. They are not pseudocoelomates. (**False**)


Step 2: {Conclusion

Only **statement A** is correct. Thus, the correct answer is **(3) A only**. Quick Tip: Coelomates have a body cavity completely lined by mesoderm, while pseudocoelomates have a body cavity partially lined with mesoderm. Acoelomates lack a body cavity.

Step 1: {Understand Transcription Process

DNA-dependent RNA polymerase synthesizes an mRNA strand complementary to the template DNA strand using the base-pairing rule:
- Adenine (A) pairs with Uracil (U) in RNA.
- Thymine (T) pairs with Adenine (A).
- Cytosine (C) pairs with Guanine (G).
- Guanine (G) pairs with Cytosine (C).

Step 2: {Convert DNA to mRNA

Using the given DNA template strand (3' TACATGGCAAATTACCATTCA 5'), the complementary mRNA strand will be: \[ 5' AUGUACCGUUUUAAGGUAAAGU 3' \]
This matches option **(2)**.

Step 3: {Conclusion

The correct answer is **(2) 5' AUGUACCGUUUUAAGGUAAAGU3'**. Quick Tip: During transcription, the RNA strand is synthesized in the **5' to 3' direction**, complementary to the DNA template strand.

Step 1: {Understanding Hardy-Weinberg Equilibrium

The Hardy-Weinberg principle states that the allele and genotype frequencies in a population remain constant over generations if evolutionary influences are absent.

Step 2: {Analyzing the Given Options

- **Constant gene pool** ensures no evolutionary forces act, maintaining equilibrium. (**Correct Answer**)
- **Genetic recombination** introduces variation, altering allele frequencies. (**Affects equilibrium**)
- **Genetic drift** causes random fluctuations in allele frequencies, violating Hardy-Weinberg. (**Affects equilibrium**)
- **Gene migration** leads to introduction/removal of alleles, disrupting equilibrium. (**Affects equilibrium**)


Step 3: {Conclusion

Only **option (1) Constant gene pool** maintains Hardy-Weinberg equilibrium. Quick Tip: Hardy-Weinberg equilibrium assumes **no mutation, no selection, no migration, no genetic drift, and random mating**.

Step 1: {Understanding Ti Plasmid

The **Ti (Tumor-inducing) plasmid** is a **circular DNA** found in \textit{Agrobacterium tumefaciens, a bacterium responsible for causing crown gall disease in plants.

Step 2: {Function of the Ti Plasmid

- It carries **T-DNA** (Transfer DNA) which integrates into the plant genome.
- This integration leads to uncontrolled cell division, resulting in tumors.

Step 3: {Conclusion

Since the Ti plasmid **induces tumors** in plants, the correct answer is **option (4) Tumor inducing plasmid**. Quick Tip: Ti plasmids are used in genetic engineering to transfer foreign genes into plants.

Step 1: {Analyze Statement I

- The **descending limb of Henle’s loop** is **permeable to water** but **impermeable to electrolytes**.
- Since Statement I incorrectly states that it is impermeable to water, it is **false**.

Step 2: {Analyze Statement II

- The **proximal convoluted tubule (PCT)** is lined by **simple cuboidal** brush border epithelium, **not columnar**.
- Since Statement II incorrectly states it is columnar, it is also **false**.

Step 3: {Conclusion

Since both statements contain incorrect information, the correct answer is **option (3) Both Statement I and Statement II are false**. Quick Tip: The **descending limb** of the nephron loop absorbs **water**, while the **ascending limb** absorbs **electrolytes**.

Step 1: {Understanding Enzymes and Their Action

- **Lipase** breaks down lipids and hydrolyzes **ester bonds**.

- **Nuclease** cleaves nucleotides by hydrolyzing **phosphodiester bonds** in nucleic acids.

- **Protease** hydrolyzes **peptide bonds** in proteins.

- **Amylase** breaks down polysaccharides by hydrolyzing **glycosidic bonds**.


Step 2: {Matching List-I and List-II

- **A-II** (Lipase → Ester bond) ✅

- **B-IV** (Nuclease → Phosphodiester bond) ✅

- **C-I** (Protease → Peptide bond) ✅

- **D-III** (Amylase → Glycosidic bond) ✅


Step 3: {Conclusion

The correct answer is **option (4) A-II, B-IV, C-I, D-III**. Quick Tip: Each enzyme targets a specific bond: Lipase (Ester), Nuclease (Phosphodiester), Protease (Peptide), and Amylase (Glycosidic).

Step 1: {Understanding Joint Types

- **Fibrous joints** are **immovable** and found in the **skull**.

- **Cartilaginous joints** allow **limited movement** and are present in the **vertebrae**.

- **Hinge joints** allow **one-directional movement** and are present in the **knee**.

- **Ball and socket joints** allow **free rotational movement** and are found in the **shoulder (humerus and pectoral girdle)**.


Step 2: {Matching List-I and List-II

- **A-III** (Fibrous joints → Skull, no movement) ✅

- **B-I** (Cartilaginous joints → Vertebrae, limited movement) ✅

- **C-IV** (Hinge joints → Knee, helps in locomotion) ✅

- **D-II** (Ball and socket joints → Humerus & Pectoral girdle) ✅


Step 3: {Conclusion

The correct answer is **option (1) A-III, B-I, C-IV, D-II**. Quick Tip: Fibrous joints are **immovable**, cartilaginous joints allow **limited movement**, hinge joints allow **one-directional movement**, and ball & socket joints provide **maximum mobility**.

Step 1: {Understanding the Electrical Conduction System of the Heart

- The **SA node (E)** initiates the heartbeat and acts as the natural pacemaker.

- The electrical impulse moves to the **AV node (C)**, which delays the signal slightly.

- Then, the signal passes to the **AV bundle (A)**, also called the Bundle of His.

- From there, it travels to the **Bundle branches (D)** in the interventricular septum.

- Finally, the signal reaches the **Purkinje fibers (B)**, which help in ventricular contraction.


Step 2: {Correct Sequence

- **E → C → A → D → B** matches option **(2)**. ✅


Step 3: {Conclusion

The correct answer is **option (2) E-C-A-D-B**. Quick Tip: The correct sequence for heart conduction is: **SA node → AV node → AV bundle → Bundle branches → Purkinje fibers**.

Step 1: {Understanding the Function of Bio-reactors

- **Bio-reactors** are designed for **large-scale production** of microbial, plant, and animal cell cultures.

- They provide **controlled conditions** like **temperature, pH, aeration, and mixing** to optimize microbial growth.


Step 2: {Evaluating the Options

- **Statement 1** is correct ✅ (Bio-reactors have an agitator, oxygen delivery, and foam control systems).

- **Statement 2** is correct ✅ (Bio-reactors provide optimal growth conditions).

- **Statement 3** is correct ✅ (Most bio-reactors use stirring-type mechanisms).

- **Statement 4** is incorrect ❌ (Bio-reactors are used for large-scale, not small-scale production).


Step 3: {Conclusion

The incorrect statement is **option (4) Bio-reactors are used to produce small-scale bacterial cultures**. Quick Tip: Bio-reactors are **large-scale fermentation systems** that provide an optimal environment for **mass production** of microbial or cellular products.

The 'X' gene controls the replication of linked DNA and the 'Y' gene encodes a protein essential for plasmid replication. Quick Tip: In molecular biology, plasmids are used in genetic engineering as vectors to transfer genes into cells.

- **A**: Common cold is caused by **Rhinoviruses** (III).

- **B**: Haemozoin is associated with **Plasmodium** (I).

- **C**: Widal test is used for **Typhoid** (II).

- **D**: Allergy is triggered by **Dust mites** (IV).


Thus, the correct answer is **option (4)**. Quick Tip: Haemozoin is a byproduct of the breakdown of hemoglobin by Plasmodium in malaria infections.

- **A**: Axoneme is associated with **Cilia and flagella** (II).

- **B**: Cartwheel pattern is seen in **Centriole** (I).

- **C**: Crista is found in **Mitochondria** (IV).

- **D**: Satellite is found on the **Chromosome** (III).


Thus, the correct answer is **option (1)**. Quick Tip: Axonemes are the structural cores of cilia and flagella, composed of microtubules.

Non-chordates lack a notochord, post-anal tail, and have a dorsal heart if present. Quick Tip: Non-chordates include species like arthropods and molluscs which do not possess the notochord.

Given the blood types, the possible genotypes are for the father \( I^B \), mother \( I^A \), and child \( I^i \). Quick Tip: The ABO blood group system is determined by the alleles \( I^A \), \( I^B \), and \( i \). These are codominant, meaning that both \( I^A \) and \( I^B \) are expressed when inherited.

- Mesozic Era refers to the time period characterized by the development of reptiles, which is associated with the Birds \& Reptiles (III).
- Proterozoic Era refers to the emergence of simple life forms like lower invertebrates (I).
- Cenozoic Era marks the time of Mammals (IV).
- Paleozoic Era corresponds to the Fish \& Amphibia (II). Quick Tip: The geological eras are divided into the Hadean, Archean, Proterozoic, and Phanerozoic eons. Each of these eons represents major developments in life forms.

- The P wave corresponds to depolarisation of atria (III).
- The QRS complex corresponds to depolarisation of ventricles (II).
- The T wave corresponds to repolarisation of ventricles (IV).
- The T-P gap represents the heart muscles being electrically silent (I). Quick Tip: The P wave, QRS complex, and T wave are the key components in an ECG (electrocardiogram) tracing, which helps in understanding heart function.

- A. Exophthalmic goiter is related to excessive secretion of thyroid hormone which leads to protruding eyeballs (III).
- B. Acromegaly is due to excessive secretion of growth hormone (IV).
- C. Cushing’s syndrome is related to the excess secretion of cortisol, leading to moon face and hyperglycemia (I).
- D. Cretinism is associated with hypothyroidism, causing stunted growth and dwarfism (II). Quick Tip: Excessive secretion of growth hormone leads to conditions like acromegaly, while insufficient secretion results in conditions such as cretinism.

- Statement I is correct: Both mitochondria and chloroplasts are double-membraned organelles.
- Statement II is incorrect: The inner membrane of mitochondria is less permeable than the inner membrane of chloroplasts. Quick Tip: Mitochondria and chloroplasts are essential organelles with unique roles in energy production. Their inner membranes play a crucial role in these processes, and their structure reflects their specialized functions.

The correct sequence of catalytic cycle for an enzyme is:
1. Substrate enzyme complex formation (A),
2. Substrate binding to active site (E),
3. Chemical bonds of the substrate are broken (D),
4. Release of products (C),
5. Free enzyme is ready to bind with another substrate (B). Quick Tip: The catalytic cycle involves binding of substrate to the enzyme, breaking the chemical bonds, and releasing the products, leaving the enzyme ready for another cycle.

- A. Unicellular glandular epithelium is associated with goblet cells of the alimentary canal (III).
- B. Compound epithelium is found in the moist surface of buccal cavity (IV).
- C. Multicellular glandular epithelium is associated with salivary glands (I).
- D. Endocrine glandular epithelium is associated with the pancreas (II). Quick Tip: Unicellular glandular epithelium, like goblet cells, secrete mucus, while multicellular glands like salivary glands secrete digestive enzymes and other substances.

Juxta medullary nephrons have longer loops of Henle that extend into the medulla. This is important for maintaining the osmotic gradient necessary for urine concentration.
The renal corpuscle of juxta medullary nephrons is located near the medulla, which allows the loops of Henle to run deeper into the medulla. Quick Tip: The juxta medullary nephrons play a crucial role in regulating water and salt balance, especially in conserving water through the process of countercurrent multiplication.

Bone marrow is indeed the primary site for the production of all blood cells, including lymphocytes. Additionally, the thymus provides the micro-environment needed for the maturation of T-lymphocytes, which is crucial for the adaptive immune system. Quick Tip: The thymus plays a central role in the maturation of T-lymphocytes by providing a specialized environment where these cells undergo positive and negative selection.

- The structures used for storing food in cockroaches are found in the Crop, corresponding to (D).

- The Ring of 6-8 blind tubules at junction of foregut and midgut is known as the Gastric Caeca, corresponding to (B).

- The Ring of 100-150 yellow colored thin filaments are the Malpighian tubules, corresponding to (C).

- The Structures used for grinding food are found in the Gizzard, corresponding to (A). Quick Tip: In cockroaches, the digestive system plays an essential role in breaking down food using specialized structures like the crop, gizzard, and gastric caeca.

- Statement I is correct because the cerebral hemispheres are indeed connected by a nerve tract called the corpus callosum.

- Statement II is incorrect because the brainstem consists of the medulla oblongata, pons, and midbrain, not the cerebrum. Quick Tip: The brainstem regulates vital functions like heart rate and breathing, while the cerebrum is involved in higher brain functions such as thought, movement, and sensory processing.

- Statement I is incorrect because Gause’s principle actually states that two closely related species competing for the same limiting resources cannot coexist indefinitely, not for different resources.
- Statement II is correct because it aligns with Gause’s principle, where the inferior species gets eliminated under competitive pressure. Quick Tip: In competitive exclusion, two species competing for the same niche cannot coexist. One will inevitably outcompete the other.

- RNA polymerase III is responsible for transcribing small RNAs, corresponding to (A-IV).
- Termination of transcription involves the Rho factor, which is involved in termination, corresponding to (B-III).
- Splicing of exons involves snRNPs, which play a role in splicing, corresponding to (C-I).
- The TATA box is a crucial promoter element in gene transcription, corresponding to (D-II). Quick Tip: The TATA box is an essential DNA sequence involved in the binding of RNA polymerase and initiation of transcription.

- The hormonal regulation of spermatogenesis involves GnRH (Gonadotropin-releasing hormone) stimulating the release of LH (Luteinizing hormone) and FSH (Follicle-stimulating hormone).
- LH acts on Leydig cells to produce androgens, which are necessary for spermatogenesis.
- FSH, on the other hand, acts on Sertoli cells, supporting the maturation of spermatids. Quick Tip: FSH and LH regulate different aspects of spermatogenesis. FSH acts on Sertoli cells to nourish the developing sperm, while LH stimulates Leydig cells to produce androgens, essential for sperm development.