NEET 2024 Zoology Question Paper with Answers and Solutions PDF S2

A: \(\alpha\)-I antitrypsin is related to Emphysema (due to deficiency leading to lung damage).
B: Cry IAb is associated with controlling Cotton bollworm.
C: Cry IAc is associated with controlling Corn borer.
D: Enzyme replacement therapy is used in treating ADA deficiency (Adenosine Deaminase deficiency).

Thus, the correct answer is (4).

% Correct Answer
Correct Answer: (4) Quick Tip: Cry proteins are toxins produced by Bacillus thuringiensis, which are used as biopesticides, effective against specific pests like cotton bollworms and corn borers.

The uterine fundus is part of the uterus, not the Fallopian tube. The Fallopian tube consists of the ampulla, isthmus, and infundibulum.

% Correct Answer
Correct Answer: (2) Quick Tip: The Fallopian tube is involved in the transport of the egg from the ovary to the uterus and consists of four parts: infundibulum, ampulla, isthmus, and interstitial part.

The Ti plasmid (Tumor inducing plasmid) of *Agrobacterium tumefaciens* is responsible for causing crown gall disease in plants by transferring genes that lead to tumor formation.

% Correct Answer
Correct Answer: (4) Quick Tip: The Ti plasmid is used in genetic engineering for creating genetically modified plants, as it can transfer specific genes to plant cells, causing tumor growth.

The constant gene pool is one of the conditions for Hardy-Weinberg equilibrium. All other factors such as genetic recombination, genetic drift, and gene migration can lead to deviations from the equilibrium.

% Correct Answer
Correct Answer: (1) Quick Tip: The Hardy-Weinberg equilibrium assumes that no evolution occurs in a population, which means factors like mutation, migration, and genetic drift must not affect allele frequencies.

The correct pathway for conduction of an action potential in the heart is: SA node → AV node → AV bundle → Bundle branches → Purkinje fibres.

Thus, the correct answer is (2).

% Correct Answer
Correct Answer: (2) Quick Tip: The conduction pathway ensures that the heart beats in a coordinated manner. The action potential travels from the SA node to the AV node, then through the AV bundle, bundle branches, and Purkinje fibres to trigger the heart's contraction.

Statement I is incorrect because the descending limb of the loop of Henle is permeable to water, not to electrolytes.
Statement II is correct because the proximal convoluted tubule is lined with simple cuboidal epithelium with microvilli, which increases the surface area for reabsorption.

Thus, the correct answer is **(3)**.

% Correct Answer
Correct Answer: (3) Quick Tip: The descending limb of the loop of Henle is permeable to water and allows for water reabsorption, while the ascending limb is impermeable to water but allows the transport of ions.

A: Down's syndrome is caused by an extra copy of chromosome 21.
B: \(\alpha\)-Thalassemia is caused by mutations on chromosome 16.
C: \(\beta\)-Thalassemia is caused by mutations on chromosome 11.
D: Klinefelter's syndrome is caused by the presence of an extra X chromosome.

Thus, the correct answer is (4).

% Correct Answer
Correct Answer: (4) Quick Tip: Chromosomal abnormalities such as Down's syndrome, Klinefelter's syndrome, and thalassemia are often caused by mutations or aneuploidy in specific chromosomes.

The correct sequence of human evolution is: Homo habilis → Homo erectus → Homo neanderthalensis → Homo sapiens.

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: Human evolution progressed from early hominins like Homo habilis, to more advanced species like Homo sapiens, with intermediary species such as Homo erectus and Homo neanderthalensis.

The flippers of Penguins and Dolphins are an example of **convergent evolution** because they have evolved similar structures due to similar environmental pressures, despite having different evolutionary origins.

% Correct Answer
Correct Answer: (4) Quick Tip: Convergent evolution occurs when unrelated species evolve similar traits due to similar selective pressures, such as the flippers of penguins and dolphins adapted for swimming.

A: Diakinesis is associated with the appearance of recombination nodules.
B: Pachytene is associated with the completion of terminalisation of chiasmata.
C: Zygotene is the stage when chromosomes look like thin threads.
D: Leptotene is the stage of synaptonemal complex formation.

Thus, the correct answer is (4).

% Correct Answer
Correct Answer: (4) Quick Tip: Meiosis consists of several stages, including Leptotene, Zygotene, Pachytene, and Diakinesis, each characterized by specific chromosomal events and structures.

A: Typhoid is caused by Bacteria.
B: Leishmaniasis is caused by Protozoa.
C: Ringworm is caused by a Fungus.
D: Filarisis is caused by a Nematode.

Thus, the correct answer is (3).

% Correct Answer
Correct Answer: (3) Quick Tip: Typhoid, Leishmaniasis, Ringworm, and Filarisis are caused by different types of pathogens: bacteria, protozoa, fungi, and nematodes, respectively.

A: Pons connects different regions of the brain.
B: Hypothalamus has neurosecretory cells.
C: Medulla controls respiration and gastric secretions.
D: Cerebellum provides additional space for neurons, regulates posture and balance.

Thus, the correct answer is (4).

% Correct Answer
Correct Answer: (4) Quick Tip: The brain regions such as the Pons, Hypothalamus, Medulla, and Cerebellum play critical roles in body functions like movement coordination, respiratory control, and homeostasis.

The RNA polymerase will read the template strand and synthesize the complementary RNA strand in the 5' to 3' direction. The complementary strand of the given template would be 5' AUGUAAAGUUUAGGGAAAGGU 3'.

% Correct Answer
Correct Answer: (3) Quick Tip: RNA polymerase synthesizes RNA in the 5' to 3' direction by complementary base pairing with the template DNA strand.

A: Pterophyllum is associated with Angel fish.
B: Myxine is associated with Hag fish.
C: Pristis is associated with Saw fish.
D: Exocoetus is associated with Flying fish.

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: Pterophyllum is a species of freshwater fish commonly known as the Angelfish, Myxine is known as the Hagfish, Pristis refers to the Sawfish, and Exocoetus is known as the Flying fish.

Annelids are true coelomates, while Poriferans, Aschelminthes, and Platyhelminthes have different types of body cavities, with Aschelminthes being acoelomates and Platyhelminthes being pseudocoelomates.

Thus, the correct answer is (3).

% Correct Answer
Correct Answer: (3) Quick Tip: Annelids are true coelomates, meaning they possess a true coelom. Poriferans do not have a proper body cavity, and Aschelminthes and Platyhelminthes are examples of pseudocoelomates.

A: Common cold is caused by Rhinoviruses.
B: Haemozoin is associated with Plasmodium, the malaria parasite.
C: Widal test is used for diagnosing Typhoid.
D: Allergy is caused by Dust mites.

Thus, the correct answer is (4).

% Correct Answer
Correct Answer: (4) Quick Tip: Common cold is caused by Rhinoviruses, and Malaria is caused by Plasmodium, with Haemozoin being a byproduct of the parasite. Widal test is used for diagnosing Typhoid, and Dust mites are common allergens causing allergies.

Bio-reactors are typically used to produce large-scale cultures, not small-scale cultures.

Thus, the correct answer is (4).

% Correct Answer
Correct Answer: (4) Quick Tip: Bio-reactors are essential in biotechnology for growing microorganisms on a large scale for the production of various products like medicines, enzymes, and biofuels.

Assertion A is false because FSH acts on ovarian follicles in females but is not involved in Leydig cells in males. Reason R is true because ovarian follicles secrete estrogen in females, and Leydig cells secrete androgen in males.

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: FSH plays a key role in the reproductive system by stimulating the development of ovarian follicles in females and controlling testosterone production in males.

The correct sequence of stages in cell division is: Gap 1 phase → Synthesis phase → Gap 2 phase → Karyokinesis → Cytokinesis.

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: The stages of cell division follow a specific order: G1 phase (preparation), S phase (DNA replication), G2 phase (further preparation), followed by M phase (mitosis and cytokinesis).

Statement I is true because the presence or absence of the hymen is not a definitive indicator of virginity.
Statement II is false because the hymen can be torn due to various reasons other than the first coitus, such as physical activity or medical procedures.

Thus, the correct answer is (4).

% Correct Answer
Correct Answer: (4) Quick Tip: The hymen may be stretched or torn due to reasons unrelated to sexual activity, making it an unreliable marker of virginity.

**Vaults** are not a natural or traditional contraceptive method. Vaults refer to a type of contraceptive device, not a traditional or natural method.

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: Natural contraceptive methods include coitus interruptus, periodic abstinence, and lactational amenorrhea. Vaults, however, refer to an artificial method of contraception.

A: Fibrous joints are found in the skull and do not allow movement (III).
B: Cartilaginous joints are found between adjacent vertebrae and allow limited movement (I).
C: Hinge joints are found in the knee and elbow and help in movement (IV).
D: Ball and socket joints are found in the shoulder and hip, allowing rotational movement (II).

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: Joints are classified based on their structure and function. Ball and socket joints provide the most movement, while fibrous joints offer minimal movement.

The gene 'X' controls the copy number of the linked DNA and gene 'Y' is involved in protein production necessary for plasmid replication.

Thus, the correct answer is (3).

% Correct Answer
Correct Answer: (3) Quick Tip: Plasmid vectors are used for cloning DNA and often contain genes for antibiotic resistance and replication control.

The formation of oxyhaemoglobin is favoured by low pCO₂ and high pO₂, which occurs in the alveoli where oxygen binds to haemoglobin for transport.

Thus, the correct answer is **(4)**.

% Correct Answer
Correct Answer: (4) Quick Tip: In the alveoli, high oxygen levels and low carbon dioxide levels favour the binding of oxygen to haemoglobin, forming oxyhaemoglobin.

The anal cerci in cockroaches are present on the **10^th segment**.

Thus, the correct answer is **(3)**.

% Correct Answer
Correct Answer: (3) Quick Tip: Anal cerci in cockroaches serve sensory functions, helping to detect air currents and vibrations.

A: Non-medicated IUD is associated with Lippes loop (III).
B: Copper releasing IUD is associated with Multiload 375 (I).
C: Hormone releasing IUD is associated with LNG-20 (IV).
D: Implants are associated with Progestogens (II).

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: IUDs are popular methods of contraception, and the different types include copper-releasing and hormone-releasing IUDs, as well as non-medicated devices like the Lippes loop.

A: Expiratory capacity is Expiratory reserve volume + Tidal volume + Inspiratory reserve volume (I).
B: Functional residual capacity is Tidal volume + Expiratory reserve volume (II).
C: Vital capacity is Tidal volume + Inspiratory reserve volume (III).
D: Inspiratory capacity is Expiratory reserve volume + Residual volume (IV).

Thus, the correct answer is (2).

% Correct Answer
Correct Answer: (2) Quick Tip: Respiratory volumes and capacities describe different aspects of lung function and ventilation. They are useful in assessing the health of the lungs.

A: Pleurobrachia is associated with Ctenophora (II).
B: Radula is associated with Mollusca (I).
C: Stomochord is found in Hemichordata (IV).
D: Air bladder is found in Osteichthyes (III).

Thus, the correct answer is (3).

% Correct Answer
Correct Answer: (3) Quick Tip: Pleurobrachia is a member of the phylum Ctenophora, which includes marine invertebrates. The radula is a specialized feeding organ found in mollusks.

Myasthenia gravis, Rheumatoid arthritis, and Systemic Lupus Erythematosus (SLE) are autoimmune disorders.
Gout and Muscular dystrophy are not considered autoimmune disorders.

Thus, the correct answer is (3).

% Correct Answer
Correct Answer: (3) Quick Tip: Autoimmune diseases occur when the body's immune system mistakenly attacks its own tissues. Conditions like rheumatoid arthritis and lupus are classic examples.

A: Cocaine is obtained from Erythroxylum (III).
B: Heroin is obtained from Papaver somniferum (IV).
C: Morphine is obtained from Papaver somniferum (IV).
D: Marijuana is obtained from Cannabis sativa (II).

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: Cocaine, heroin, and morphine are all drugs derived from plant sources, while marijuana comes from Cannabis sativa. Morphine is often used in medical practice for its pain-relieving properties.

A: Axoneme is a structure found in Cilia and flagella (II).
B: Cartwheel pattern is found in the Centriole (I).
C: Crista is found in Mitochondria (IV).
D: Satellite is associated with Chromosome (III).

Thus, the correct answer is (1).

% Correct Answer
Correct Answer: (1) Quick Tip: The axoneme is the central shaft of cilia and flagella and is involved in movement. Cristae are folds in the inner mitochondrial membrane, important for energy production in mitochondria.

- **Involuntary muscle** is found in the **nose tip** (a).
- **Skeletal muscle** is found in the **legs** (b).
- **Cardiac muscle** is found in the **heart** (c).

Thus, the correct answer is **(2)**.

% Correct Answer
Correct Answer: (2) Quick Tip: Involuntary muscles are not under conscious control and are found in structures such as the heart, stomach, and intestines. Skeletal muscles are responsible for voluntary movement and are attached to bones.

- Lipase acts on ester bonds (A-II).
- Nuclease acts on phosphodiester bonds (B-IV).
- Protease acts on peptide bonds (C-I).
- Amylase acts on glycosidic bonds (D-III).

Thus, the correct answer is **(4)**. Quick Tip: Enzymes are proteins that catalyze biochemical reactions. Each enzyme has a specific substrate and bond type it acts upon, such as ester, phosphodiester, peptide, or glycosidic bonds.

- Glucagon is a peptide hormone, not a steroid hormone.
- Cortisol, testosterone, and progesterone are all steroid hormones.

Thus, the correct answer is **(1)**. Quick Tip: Steroid hormones are derived from cholesterol and are lipophilic, meaning they can pass through cell membranes. Examples include cortisol, testosterone, and progesterone.

The correct sequence of the catalytic cycle is:
- E. Substrate binding to active site.
- A. Substrate enzyme complex formation.
- D. Chemical bonds of the substrate broken.
- C. Release of products.
- B. Free enzyme ready to bind with another substrate.

Thus, the correct answer is **(2)**. Quick Tip: The catalytic cycle of an enzyme involves the binding of the substrate to the enzyme, the breaking of substrate bonds, release of products, and the enzyme becoming available to bind to a new substrate.

- Statement I is correct as bone marrow is indeed the primary site of blood cell production, including lymphocytes.
- Statement II is also correct as both the bone marrow and thymus are involved in the development and maturation of T-lymphocytes.

Thus, the correct answer is **(2)**. Quick Tip: Bone marrow is responsible for the production of blood cells, including lymphocytes, whereas the thymus provides the environment for the maturation of T-lymphocytes.

- Exophthalmic goiter is caused by hypersecretion of thyroid hormone and protruding eye balls (A-III).
- Acromegaly is caused by excessive secretion of growth hormone (B-IV).
- Cushing's syndrome is caused by excess secretion of cortisol, moon face, and hyperglycemia (C-I).
- Cretinism is caused by hyposecretion of thyroid hormone leading to stunted growth (D-II).

Thus, the correct answer is **(1)**. Quick Tip: Endocrine disorders can be caused by both hypersecretion and hyposecretion of hormones. These disorders can lead to various symptoms such as stunted growth, protruding eye balls, or excessive facial changes.

- RNA polymerase II is involved in snRNPs (A-IV).
- Termination of transcription is regulated by the Rho factor (B-III).
- Splicing of Exons involves snRNAs, tRNA (C-II).
- The TATA box is associated with the promotor (D-I).

Thus, the correct answer is **(1)**. Quick Tip: In gene expression, RNA polymerase II is responsible for transcription, while splicing and termination involve specific RNA sequences and proteins like snRNAs, tRNA, and Rho factor.

- Statement I is correct: The cerebral hemispheres are indeed connected by the nerve tract known as the corpus callosum.
- Statement II is incorrect: The brainstem consists of the medulla oblongata, pons, and midbrain (not cerebrum).

Thus, the correct answer is (4). Quick Tip: The corpus callosum connects the left and right cerebral hemispheres, and the brainstem includes the medulla oblongata, pons, and midbrain, not the cerebrum.

- Unicellular glandular epithelium is found in Goblet cells of alimentary canal (A-III).
- Compound epithelium is found in Moist surface of buccal cavity (B-IV).
- Multicellular glandular epithelium is found in Salivary glands (C-I).
- Endocrine glandular epithelium is found in Pancreas (D-II).

Thus, the correct answer is (4). Quick Tip: Unicellular epithelium forms structures like goblet cells, while multicellular epithelium forms glands such as salivary glands and the pancreas. Endocrine glands secrete hormones and are important for metabolic regulation.

- Statement I is correct: Both mitochondria and chloroplasts have double membranes.
- Statement II is incorrect: The inner membrane of mitochondria is more impermeable compared to chloroplasts, not less.

Thus, the correct answer is (4). Quick Tip: Mitochondria and chloroplasts both contain double membranes, but the permeability of the inner membranes differs. The inner mitochondrial membrane is relatively less permeable compared to the chloroplast membrane.

- A (The structures used for storing food) corresponds to the Crop (A-I).
- B (Ring of 6-8 blind tubules at the junction of foregut and midgut) corresponds to the Gastric Caeca (B-II).
- C (Ring of 100-150 yellow-colored thin filaments at junction of midgut and hindgut) corresponds to the Malpighian tubules (C-III).
- D (The structures used for grinding food) corresponds to the Gizzard (D-IV).

Thus, the correct answer is (2). Quick Tip: In the digestive system of a cockroach, the crop is used for food storage, gastric caeca help in digestion, Malpighian tubules aid in excretion, and the gizzard grinds the food.

- Statement I is false because Gause's principle states that two species may compete for the same resource, but one may be more efficient, thus driving the other to extinction.
- Statement II is true, as competition can result in the elimination of the inferior species if resources are limited.

Thus, the correct answer is (1). Quick Tip: Gause's competitive exclusion principle states that no two species can occupy the same ecological niche indefinitely when resources are limited. One species will eventually outcompete the other.

- Statement A: Pharynx with gill slits is a characteristic of some non-chordates like amphibians and fishes.
- Statement B: Notochord is absent in many non-chordates such as arthropods and molluscs.
- Statement C: The central nervous system is dorsal in most non-chordates.
- Statement D: The heart is dorsal if present in some non-chordates like arthropods.
- Statement E: Post-anal tail is absent in non-chordates like arthropods.

Thus, the correct answer is (4). Quick Tip: Non-chordates lack the notochord and may have a dorsal heart. Additionally, many lack a post-anal tail and have gill slits at some stage in their life cycle.

- The father has a B\(^+\) blood group, meaning his genotype is I\(^B\) I\(^O\).
- The mother has an A\(^+\) blood group, meaning her genotype is I\(^A\) I\(^O\).
- The child has an O\(^-\) blood group, meaning their genotype must be I\(^O\) I\(^O\).

Thus, the correct answer is (2). Quick Tip: The ABO blood type is determined by alleles I\(^A\), I\(^B\), and I\(^O\). For a child with O\(^-\) blood group, both parents must carry the I\(^O\) allele.

- Statement (1) is incorrect: Cortical nephrons are more abundant than juxta medullary nephrons.
- Statement (2) is incorrect: Juxta medullary nephrons are located near the junction of the cortex and medulla, not in the columns of Bertini.
- Statement (3) is incorrect: The renal corpuscle of juxta medullary nephron lies in the outer portion of the cortex, not the renal medulla.
- Statement (4) is correct: The Loop of Henle of juxta medullary nephrons extends deep into the medulla, which is crucial for concentrating urine.

Thus, the correct answer is (4). Quick Tip: Juxta medullary nephrons play an important role in the formation of concentrated urine. The deep penetration of the Loop of Henle into the medulla enables the kidney to conserve water.

- P wave corresponds to depolarisation of atria (A-III).
- QRS complex corresponds to depolarisation of ventricles (B-II).
- T wave corresponds to repolarisation of ventricles (C-I).
- T-P gap corresponds to heart muscles are electrically silent (D-IV).

Thus, the correct answer is (3). Quick Tip: The P wave, QRS complex, and T wave are part of the electrocardiogram (ECG) that represents the electrical activity of the heart. The T-P gap represents the phase when the heart muscles are electrically silent.