NEET 2024 Zoology Question Paper with Answers and Solutions PDF T1

NEET 2024 Question Paper With Solution 

Question 151:

Match List I with List II

Choose the correct answer from the options given below:

1. A-III, B-IV, C-I, D-II
2. A-IV, B-I, C-II, D-III
3. A-I, B-II, C-III, D-IV
4. A-II, B-III, C-IV, D-I

---

Question 152:

Match List I with List II

Choose the correct answer from the options given below:

1. A-II, B-IV, C-I, D-III
2. A-IV, B-III, C-II, D-I
3. A-V, B-II, C-III, D-I
4. A-I, B-II, C-IV, D-III

---

Question 153:

Which of the following factors are favorable for the formation of oxyhemoglobin in alveoli?

1. Low pCO₂ and High H⁺ concentration
2. Low pCO₂ and High temperature
3. High pO₂ and High pCO₂
4. High pO₂ and Lesser H⁺ concentration

---

Question 154:

Match List I with List II

Choose the correct answer from the options given below:

1. A-III, B-I, C-IV, D-II
2. A-II, B-IV, C-III, D-I
3. A-I, B-III, C-II, D-IV
4. A-IV, B-III, C-I, D-II

---

Question 155:

Match List I with List II

Choose the correct answer from the options given below:

1. A-II, B-I, C-IV, D-III
2. A-I, B-III, C-II, D-IV
3. A-II, B-IV, C-I, D-III
4. A-III, B-II, C-IV, D-I

---

Question 156:

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

1. B, C & E only
2. C, D & E only
3. A, B & D only
4. A, B & E only

---

Question 157:

Given below are two statements:

Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the options given below:

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false

---

Question 158:

Which of the following is not a steroid hormone?

1. Progesterone
2. Glucagon
3. Cortisol
4. Testosterone

---

Question 159:

Given below are two statements:

Assertion A: FSH acts upon ovarian follicles in females and Leydig cells in males.

Reason R: Growing ovarian follicles secrete estrogen in females, while interstitial cells secrete androgen in male human beings.

In the light of the above statements, choose the correct answer from the options given below:

1. A is true but R is false
2. A is false but R is true
3. Both A and R are true, and R is the correct explanation of A
4. Both A and R are true, but R is NOT the correct explanation of A

---

Question 160:

Given below are some stages of human evolution. Arrange them in correct sequence (Past to Recent).

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus

Choose the correct sequence of human evolution from the options given below:

1. C-B-D-A
2. A-D-C-B
3. D-A-C-B
4. B-A-D-C

---

Question 161:

Three types of muscles are given as (a), (b), and (c). Identify the correct matching pair along with their location in the human body:

1. (a) Skeletal – Biceps (b) Involuntary – Intestine (c) Smooth – Heart
2. (a) Involuntary – Nose tip (b) Skeletal – Bone (c) Cardiac – Heart
3. (a) Smooth – Toes (b) Skeletal – Legs (c) Cardiac - Heart
4. (a) Skeletal – Triceps (b) Smooth - Stomach (c) Cardiac - Heart

---

Question 162:

Match List I with List II:

Choose the correct answer from the options given below:

1. A-II, B-I, C-III, D-IV
2. A-III, B-IV, C-I, D-II
3. A-IV, B-III, C-I, D-II
4. A-I, B-II, C-III, D-IV

---

Question 163:

The "Ti plasmid" of Agrobacterium tumefaciens stands for:

1. Tumor inducing plasmid
2. Temperature independent plasmid
3. Tumor inhibiting plasmid
4. Tumor independent plasmid

---

Question 164:

Which one is the correct product of DNA-dependent RNA polymerase to the given template?

3'TCATCTGGAAATTACCTTACAS5'

1. 5' UAUGUCCUUUAAUGGAAUGU 3'
2. 5' AUGUCCUUUUAAUGGAAGU 3'
3. 5' UAGUCCUUUUAAUGGAAGU 3'
4. 5' AUGUAGUCCUUUAUGGAAGU 3'

---

Question 165:

Match List I with List II:

Choose the correct answer from the options given below :

1. A-V, B-I, C-II, D-III
2. A-II, B-I, C-III, D-IV
3. A-II, B-III, C-I, D-IV
4. A-III, B-I, C-II, D-IV

---

Question 166:

Match List I with List II:

Choose the correct answer from the options given below :

1. A-II, B-I, C-I, D-IV
2. A-III, B-I, C-IV, D-II
3. A-IV, B-III, C-II, D-I
4. A-I, B-II, C-III, D-IV

---

Question 167:

The flippers of Penguins and Dolphins are an example of:

1. Convergent evolution
2. Divergent evolution
3. Adaptive radiation
4. Natural selection

---

Question 168:

Match List I with List II:

Choose the correct answer from the options given below:

1. A-III, B-IV, C-I, D-II
2. A-II, B-IV, C-I, D-III
3. A-II, B-I, C-IV, D-III
4. A-III, B-I, C-II, D-IV

---

Question 169:

Match List I with List II:

Choose the correct answer from the options given below:

1. A-II, B-IV, C-I, D-III
2. A-II, B-I, C-IV, D-III
3. A-IV, B-III, C-II, D-I
4. A-IV, B-II, C-III, D-I

---

Question 170:

Given below are two statements: One is labeled as Assertion (A) and the other as Reason (R).

Assertion (A): Breastfeeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason (R): Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

1. A is correct but R is not correct.
2. A is not correct but R is correct.
3. Both A and R are correct, and R is the correct explanation of A.
4. Both A and R are correct, but R is NOT the correct explanation of A.

---

Question 171:

Which of the following is not a component of the Fallopian tube?

1. Infundibulum
2. Ampulla
3. Uterine fundus
4. Isthmus

---

Question 172:

Which of the following statements is incorrect?

1. Bio-reactors are used to produce small scale bacterial cultures
2. Bio-reactors have an agitator system, an oxygen delivery system, and foam control system
3. A bio-reactor provides optimal growth conditions for achieving the desired product
4. Most commonly used bio-reactors are of stirring type

---

Question 173:

Match List-I with List-II:

Choose the correct answer from the options given below:

1. A-II, B-III, C-II, D-IV
2. A-II, B-I, C-III, D-IV
3. A-II, B-IV, C-I, D-III
4. A-III, B-IV, C-II, D-I

---

Question 174:

Match List-I with List-II:

Choose the correct answer from the options given below:

1. A-II, B-IV, C-I, D-III
2. A-IV, B-I, C-III, D-II
3. A-II, B-III, C-I, D-IV
4. A-III, B-II, C-I, D-IV

---

Question 175:

Which of the following is not a natural/traditional contraceptive method?

1. Lactational amenorrhea
2. Vaults
3. Coitus interruptus
4. Periodic abstinence

---

Question 176:

Following are the stages of the pathway for conduction of an action potential through the heart:

A. AV bundle

B. Purkinje fibers

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of pathway from the options given below

1. B-D-E-C-A
2. E-A-D-B-C
3. E-C-A-D-B
4. A-E-C-B-D

---

Question 177:

Match List-I with List-II:

Choose the correct answer from the options given below:

1. A-II, B-IV, C-I, D-III
2. A-IV, B-III, C-II, D-I
3. A-IV, B-II, C-III, D-I
4. A-II, B-I, C-IV, D-III

---

Question 178:

Match List-I with List-II:

Choose the correct answer from the options given below:

1. A-III, B-I, C-II, D-IV
2. A-II, B-I, C-III, D-I
3. A-III, B-II, C-IV, D-I
4. A-II, B-III, C-I, D-IV

---

Question 179:

Consider the following statements:

A. Annelids are true coelomates.

B. Poriferans are pseudocoelomates.

C. Aschelminthes are acoelomates.

D. Platyhelminthes are pseudocoelomates.

Choose the correct answer from the options given below:

1. C only
2. D only
3. B only
4. A only

---

Question 180:

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

1. 8th and 9th segment
2. 11th segment
3. 5th segment
4. 10th segment

---

Question 181:

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below:

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false

---

Question 182:

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

1. Gene migration
2. Constant gene pool
3. Genetic recombination
4. Genetic drift

---

Question 183:

The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X' and ‘Y” genes:

1. The gene 'X' is for protein involved in replication of Plasmid and 'Y' for resistance to antibiotics.
2. Gene 'X' is responsible for recognition sites and ‘Y' is responsible for antibiotic resistance.
3. The gene 'X' is responsible for resistance to antibiotics and 'Y' for protein involved in the replication of Plasmid.
4. The gene 'X' is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.

---

Question 184:

Match List I with List II

Choose the correct answer from the options given below:

1. A-IV, B-I, C-II, D-III
2. A-III, B-I, C-IV, D-II
3. A-III, B-I, C-II, D-IV
4. A-I, B-II, C-IV, D-II

---

Question 185:

Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below:

1. B-D-E-A-C
2. E-C-A-D-B
3. C-E-D-A-B
4. E-B-D-A-C

---

Question 186:

Choose the correct statement given below regarding juxta medullary nephron:

1. Loop of Henle of juxta medullary nephron runs deep into medulla.
2. Juxta medullary nephrons outnumber the cortical nephrons.
3. Juxta medullary nephrons are located in the columns of Bertini.
4. Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.

---

Question 187:

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

Choose the most appropriate answer from the options given below:

1. B, D & E only
2. B, C & D only
3. A & C only
4. A, B & D only

---

Question 188:

Given below are two statements:

Statement I: Mitochondria and chloroplasts are both double-membrane bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.

In the light of the above statements, choose the most appropriate answer from the options given below:

1. Statement I is correct but Statement II is incorrect.
2. Statement I is incorrect but Statement II is correct.
3. Both Statement I and Statement II are correct.
4. Both Statement I and Statement II are incorrect.

---

Question 189:

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:

A. Substrate enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.

Choose the correct answer from the options given below:

1. B, A, C, D, E
2. E, D, C, B, A
3. E, A, D, C, B
4. A, E, B, D, C

---

Question 190:

Match List I with List II:

Choose the correct answer from the options given below:

1. A-II, B-III, C-I, D-IV
2. A-IV, B-III, C-I, D-III
3. A-I, B-III, C-IV, D-II
4. A-III, B-II, C-IV, D-I

---

Question 191:

Given below are two statements:

Statement I: Bone marrow is the main lymphoid organ where all blood cells, including lymphocytes, are produced.

Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.

In the light of the above statements, choose the most appropriate answer from the options given below:

1. Statement I is correct but Statement II is incorrect.
2. Statement I is incorrect but Statement II is correct.
3. Both Statement I and Statement II are correct.
4. Both Statement I and Statement II are incorrect.

---

Question 192:

Match List I with List II:

Choose the correct answer from the options given below:

1. A-III, B-IV, C-I, D-II
2. A-II, B-I, C-IV, D-III
3. A-I, B-I, C-III, D-IV
4. A-IV, B-III, C-I, D-II

---

Question 193:

Given below are two statements:

Statement I: The cerebral hemispheres are connected by a nerve tract known as the corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons, and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

1. Statement I is correct but Statement II is incorrect.
2. Statement I is incorrect but Statement II is correct.
3. Both Statement I and Statement II are correct.
4. Both Statement I and Statement II are incorrect.

---

Question 194:

Match List I with List II:

Choose the correct answer from the options given below:

1. A-III, B-IV, C-I, D-II
2. A-IV, B-III, C-I, D-II
3. A-II, B-IV, C-I, D-III
4. A-III, B-II, C-IV, D-I

---

Question 195:

Match List I with List II:

Choose the correct answer from the options given below:

1. A-I, B-II, C-IV, D-III
2. A-III, B-I, C-IV, D-II
3. A-II, B-I, C-III, D-IV
4. A-III, B-I, C-II, D-IV

---

Question 196:

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below:

1. Statement I is true but Statement II is false.
2. Statement I is false but Statement II is true.
3. Both Statement I and Statement II are true.
4. Both Statement I and Statement II are false.

---

Question 197:

Match List I with List II:

Choose the correct answer from the options given below:

1. A-III, B-IV, C-II, D-I
2. A-III, B-IV, C-I, D-II
3. A-I, B-III, C-II, D-IV
4. A-IV, B-II, C-I, D-III

---

Question 198:

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

1. FSH, Sertoli cells, Leydig cells, spermatogenesis.
2. ICSH, Leydig cells, Sertoli cells, spermatogenesis.
3. FSH, Leydig cells, Sertoli cells, spermiogenesis.
4. ICSH, Interstitial cells, Leydig cells, spermiogenesis.

---

Question 199:

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:

A. I^Bi / I^Ai / ii

B. I^BI^B / I^AI^A / ii

C. I^AI^B / I^Ai / I^Bi

D. I^Ai / I^Bi / I^Ai

E. ii / I^Ai / I^AI^B

Choose the most appropriate answer from the options given below :

1. C & B only
2. D & E only
3. A only
4. B only

---

Question 200:

Match List I with List II related to the digestive system of a cockroach:

Choose the correct answer from the options given below:

1. A-IV, B-III, C-II, D-I
2. A-III, B-II, C-IV, D-I
3. A-IV, B-II, C-III, D-I
4. A-I, B-II, C-III, D-IV

---

---

NEET Previous Year Question Papers with Answer Keys

Other UG Entrance Exams