NEET 2024 Zoology Question Paper with Answers and Solutions PDF T5

Match List I with List II

List I & & List II

A. & Pleurobrachia & I. & Mollusca

B. & Radula & II. & Ctenophora

C. & Stomachord & III. & Osteichthyes

D. & Air bladder & IV. & Hemichordata
 

• (1) A-II, B-IV, C-I, D-III
• (2) A-IV, B-III, C-II, D-I
• (3) A-IV, B-II, C-III, D-I
• (4) A-II, B-I, C-IV, D-III

Match List I with List II

List I & & List II

A. & Non-medicated IUD & I. & Multiload 375

B. & Copper releasing IUD & II. & Progestogens

C. & Hormone releasing IUD & III. & Lippes loop

D. & Implants & IV. & LNG-20
 

• (1) A-IV, B-I, C-II, D-III
• (2) A-III, B-I, C-IV, D-II
• (3) A-III, B-II, C-I, D-IV
• (4) A-I, B-III, C-IV, D-II

Match List I with List II


List I & & List II

A. & \(\alpha\)-1 antitrypsin & I. & Cotton bollworm

B. & Cry IAb & II. & ADA deficiency

C. & Cry IAc & III. & Emphysema

D. & Enzyme replacement therapy & IV. & Corn borer
 

• (1) A-III, B-IV, C-I, D-II
• (2) A-III, B-IV, C-I, D-III
• (3) A-II, B-I, C-IV, D-III
• (4) A-III, B-I, C-II, D-IV

Match List I with List II

List I & & List II

A. & Common cold & I. & \textit{Plasmodium

B. & Haemozoin & II. & Typhoid

C. & Widal test & III. & Rhinoviruses

D. & Allergy & IV. & Dust mites
 

• (1) A-III, B-I, C-II, D-IV
• (2) A-IV, B-II, C-III, D-I
• (3) A-II, B-IV, C-III, D-I
• (4) A-I, B-III, C-II, D-IV

Match List I with List II

List I & & List II

A. & Cocaine & I. & Effective sedative in surgery

B. & Heroin & II. & \textit{Cannabis sativa

C. & Morphine & III. & \textit{Erythroxylum

D. & Marijuana & IV. & \textit{Papaver somniferum
 

• (1) A-II, B-I, C-III, D-IV
• (2) A-III, B-IV, C-I, D-II
• (3) A-IV, B-III, C-I, D-II
• (4) A-I, B-III, C-II, D-IV

Match List I with List II

• (1) A-II, B-IV, C-I, D-III
• (2) A-IV, B-III, C-II, D-I
• (3) A-IV, B-II, C-III, D-I
• (4) A-I, B-II, C-IV, D-III

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

• (1) Statement I is true but Statement II is false
• (2) Statement I is false but Statement II is true
• (3) Both Statement I and Statement II are true
• (4) Both Statement I and Statement II are false

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3’ TACATGGCAAATATCCATTCA 5’

• (1) 5’ AUGUACCGUUUUAUAGGAAUAG 3’
• (2) 5’ ATGTACCGTTTATAGGTAAGT 3’
• (3) 5’ AUGUACCGUUUUAUAGGAAGU 3’
• (4) 5’ AUGUAAAGUUUAUGGAUAGU 3’

Match List I with List II

• (1) A-II, B-I, C-IV, D-III
• (2) A-I, B-III, C-II, D-IV
• (3) A-II, B-IV, C-I, D-III
• (4) A-III, B-II, C-IV, D-I

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)


Choose the most appropriate answer from the options given below:

• (1) B, C & E only
• (2) C, D & E only
• (3) A, B & D only
• (4) A, B & E only

Consider the following statements:

A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates


Choose the correct answer from the options given below:

• (1) C only
• (2) D only
• (3) B only
• (4) A only

Given below are two statements:

Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

• (1) Statement I is true but Statement II is false
• (2) Statement I is false but Statement II is true
• (3) Both Statement I and Statement II are true
• (4) Both Statement I and Statement II are false

Match List I with List II

List I & & List II

A. & Pterophyllum & I. & Hag fish

B. & Myxine & II. & Saw fish

C. & Pristis & III. & Angel fish

D. & Exocoetus & IV. & Flying fish
 

• (1) A-IV, B-I, C-II, D-III
• (2) A-III, B-II, C-I, D-IV
• (3) A-II, B-I, C-III, D-IV
• (4) A-III, B-I, C-II, D-IV

Which of the following is not a steroid hormone?

• (1) Progesterone
• (2) Glucagon
• (3) Cortisol
• (4) Testosterone

Match List I with List II


List I & & List II

A. & Lipase & I. & Peptide bond

B. & Nuclease & II. & Ester bond

C. & Protease & III. & Glycosidic bond

D. & Amylase & IV. & Phosphodiester bond
 

• (1) A-II, B-IV, C-I, D-III
• (2) A-IV, B-I, C-III, D-II
• (3) A-I, B-II, C-IV, D-III
• (4) A-III, B-II, C-I, D-IV

Match List I with List II

List I & & List II

A. & Down’s syndrome & I. & 11\(^{th}\) chromosome

B. & \(\alpha\)-Thalassemia & II. & ‘X’ chromosome

C. & \(\beta\)-Thalassemia & III. & 21\(^{st}\) chromosome

D. & Klinefelter’s syndrome & IV. & 16\(^{th}\) chromosome
 

• (1) A-III, B-IV, C-I, D-II
• (2) A-IV, B-I, C-II, D-III
• (3) A-I, B-II, C-III, D-IV
• (4) A-II, B-III, C-IV, D-I

The "Ti plasmid" of Agrobacterium tumefaciens stands for:

• (1) Tumor inducing plasmid
• (2) Temperature independent plasmid
• (3) Tumour inhibiting plasmid
• (4) Tumor independent plasmid

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) A is correct but R is not correct
• (2) A is not correct but R is correct
• (3) Both A and R are correct and R is the correct explanation of A
• (4) Both A and R are correct but R is NOT the correct explanation of A

Which of the following is not a component of the Fallopian tube?

• (1) Infundibulum
• (2) Ampulla
• (3) Uterine fundus
• (4) Isthmus

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

• (1) 8\(^{th}\) and 9\(^{th}\) segment
• (2) 11\(^{th}\) segment
• (3) 9\(^{th}\) segment
• (4) 10\(^{th}\) segment

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

• (1) Gene migration
• (2) Constant gene pool
• (3) Genetic recombination
• (4) Genetic drift

Match List I with List II

List I & & List II

A. & Pons & I. & Provides space for neurons, regulates posture and balance

B. & Hypothalamus & II. & Controls respiration and gastric secretions

C. & Medulla & III. & Connects different regions of the brain

D. & Cerebellum & IV. & Neurosecretory cells
 

• (1) A-I, B-III, C-II, D-IV
• (2) A-I, B-I, C-III, D-II
• (3) A-II, B-III, C-I, D-IV
• (4) A-III, B-IV, C-II, D-I

The flippers of Penguins and Dolphins are an example of:

• (1) Convergent evolution
• (2) Divergent evolution
• (3) Adaptive radiation
• (4) Natural selection

Following are the stages of pathway for conduction of an action potential through the heart

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node


Choose the correct sequence of pathway from the options given below:

• (1) B-D-E-C-A
• (2) E-A-D-B-C
• (3) E-C-A-D-B
• (4) A-E-C-B-D

The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:

• (1) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
• (2) Gene ’X’ is responsible for recognition sites and ‘Y’ is responsible for antibiotic resistance.
• (3) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.
• (4) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.

Given below are two statements: One is labelled as Assertion A and the other as Reason R:

Assertion A: FSH acts upon ovarian follicles in females and Leydig cells in males.

Reason R: Growing ovarian follicles secrete estrogen in females, while interstitial cells secrete androgens in males.

In the light of the above statements, choose the correct answer from the options given below:

• (1) A is true but R is false
• (2) A is false but R is true
• (3) Both A and R are true and R is the correct explanation of A
• (4) Both A and R are true but R is NOT the correct explanation of A

Which of the following statements is incorrect?

• (1) Bio-reactors are used to produce small scale bacterial cultures
• (2) Bio-reactors have an agitator system, an oxygen delivery system and foam control system
• (3) A bio-reactor provides optimal growth conditions for achieving the desired product
• (4) Most commonly used bio-reactors are of stirring type

Match List I with List II

List I & & List II

A. & Axoneme & I. & Centriole

B. & Cartwheel pattern & II. & Cilia and flagella

C. & Crista & III. & Chromosome

D. & Satellite & IV. & Mitochondria
 

• (1) A-II, B-IV, C-I, D-III
• (2) A-II, B-I, C-IV, D-III
• (3) A-IV, B-III, C-II, D-I
• (4) A-IV, B-II, C-III, D-I

Match List I with List II

List I & & List II

A. & Fibrous joints & I. & Adjacent vertebrae, limited movement

B. & Cartilaginous joints & II. & Humerus and Pectoral girdle, rotational movement

C. & Hinge joints & III. & Skull, don’t allow any movement

D. & Ball and socket joints & IV. & Knee, help in locomotion
 

• (1) A-II, B-III, C-IV, D-I
• (2) A-III, B-I, C-IV, D-II
• (3) A-IV, B-II, C-III, D-I
• (4) A-I, B-III, C-II, D-IV

Given below are some stages of human evolution. Arrange them in correct sequence (Past to Recent).

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus


Choose the correct sequence of human evolution from the options given below:

• (1) C-B-D-A
• (2) A-D-C-B
• (3) D-A-C-B
• (4) B-A-D-C

Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:






Name of muscle/location

• (1) (a) Skeletal – Biceps \quad (b) Involuntary – Intestine \quad (c) Smooth – Heart
• (2) (a) Involuntary – Nose tip \quad (b) Skeletal – Bone \quad (c) Cardiac – Heart
• (3) (a) Smooth – Toes \quad (b) Skeletal – Legs \quad (c) Cardiac – Heart
• (4) (a) Skeletal – Triceps \quad (b) Smooth – Stomach \quad (c) Cardiac – Heart

Following are the stages of cell division:

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase


Choose the correct sequence of stages from the options given below:

• (1) B-D-E-A-C
• (2) E-C-A-D-B
• (3) C-E-D-A-B
• (4) E-B-D-A-C

Which of the following is not a natural/traditional contraceptive method?

• (1) Lactational amenorrhea
• (2) Vaults
• (3) Coitus interruptus
• (4) Periodic abstinence

Match List I with List II

List I & & List II

A. & Typhoid & I. & Fungus

B. & Leishmaniasis & II. & Nematode

C. & Ringworm & III. & Protozoa

D. & Filariasis & IV. & Bacteria
 

• (1) A-III, B-I, C-IV, D-II
• (2) A-II, B-IV, C-III, D-I
• (3) A-I, B-III, C-II, D-IV
• (4) A-IV, B-III, C-I, D-II

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

• (1) Low pCO\(_2\) and High H\(^+\) concentration
• (2) Low pCO\(_2\) and High temperature
• (3) High pO\(_2\) and High pCO\(_2\)
• (4) High pO\(_2\) and Lesser H\(^+\) concentration

Given below are two statements:

Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.


In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Statement I is correct but Statement II is incorrect.
• (2) Statement I is incorrect but Statement II is correct.
• (3) Both Statement I and Statement II are correct.
• (4) Both Statement I and Statement II are incorrect.

Match List I with List II

List I & & List II

A. & P wave & I. & Heart muscles are electrically silent.

B. & QRS complex & II. & Depolarisation of ventricles.

C. & T wave & III. & Depolarisation of atria.

D. & T-P gap & IV. & Repolarisation of ventricles.
 

• (1) A-II, B-III, C-I, D-IV
• (2) A-IV, B-II, C-I, D-III
• (3) A-I, B-III, C-IV, D-II
• (4) A-III, B-II, C-IV, D-I

Given below are two statements:

Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons, and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

• (1) Statement I is correct but Statement II is incorrect.
• (2) Statement I is incorrect but Statement II is correct.
• (3) Both Statement I and Statement II are correct.
• (4) Both Statement I and Statement II are incorrect.

Match List I with List II

List I & & List II

A. & Unicellular glandular epithelium & I. & Salivary glands

B. & Compound epithelium & II. & Pancreas

C. & Multicellular glandular epithelium & III. & Goblet cells of alimentary canal

D. & Endocrine glandular epithelium & IV. & Moist surface of buccal cavity
 

• (1) A-III, B-IV, C-I, D-II
• (2) A-II, B-I, C-IV, D-III
• (3) A-II, B-III, C-I, D-IV
• (4) A-IV, B-III, C-I, D-II

Match List I with List II related to digestive system of cockroach:

• (1) A-III, B-IV, C-I, D-II
• (2) A-III, B-I, C-IV, D-II
• (3) A-IV, B-II, C-III, D-I
• (4) A-I, B-III, C-II, D-IV

Match List I with List II

List I & & List II

A. & Mesozoic Era & I. & Lower invertebrates

B. & Proterozoic Era & II. & Fish \& Amphibia

C. & Cenozoic Era & III. & Birds \& Reptiles

D. & Paleozoic Era & IV. & Mammals
 

• (1) A-II, B-I, C-IV, D-III
• (2) A-III, B-I, C-IV, D-II
• (3) A-I, B-II, C-III, D-IV
• (4) A-III, B-I, C-II, D-IV

Given below are two statements:

Statement I: Mitochondria and chloroplasts are both double-membrane bound organelles.

Statement II: The inner membrane of mitochondria is relatively less permeable compared to the chloroplast.

In the light of the above statements, choose the correct answer from the options given below:

• (1) Statement I is correct but Statement II is incorrect.
• (2) Statement I is incorrect but Statement II is correct.
• (3) Both Statement I and Statement II are correct.
• (4) Both Statement I and Statement II are incorrect.

As per the ABO blood grouping system, the blood group of the father is B\(^+\), mother is A\(^+\), and child is O\(^-\). Their respective genotypes can be:


Options:

A. I\(^B\)i/I\(^B\)i

B. I\(^B\)I\(^A\)/I\(^A\)i

C. I\(^A\)I\(^B\)/I\(^B\)i

D. I\(^A\)i/I\(^B\)i

E. ii/I\(^B\)i/I\(^A\)I\(^B\)


Choose the most appropriate answer from the options given below:

• (1) C & B only
• (2) D & E only
• (3) A & D only
• (4) B only

Match List I with List II

List I & & List II

A. & Exophthalmic goiter & I. & Excess secretion of cortisol, moon face \& hyperglycemia.

B. & Acromegaly & II. & Hypo-secretion of thyroid hormone and stunted growth.

C. & Cushing’s syndrome & III. & Hyper secretion of thyroid hormone \& protruding eyeballs.

D. & Cretinism & IV. & Excessive secretion of growth hormone.
 

• (1) A-III, B-IV, C-II, D-I
• (2) A-III, B-IV, C-I, D-II
• (3) A-I, B-II, C-III, D-IV
• (4) A-IV, B-I, C-II, D-III

Match List I with List II:

List I & & List II

A. & RNA polymerase III & I. & snRNPs

B. & Termination of transcription & II. & Promotor

C. & Splicing of Exons & III. & Rho factor

D. & TATA box & IV. & SnRNAs, tRNA
 

• (1) A-III, B-IV, C-I, D-II
• (2) A-IV, B-II, C-I, D-III
• (3) A-II, B-III, C-IV, D-I
• (4) A-III, B-II, C-IV, D-I

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

• (1) FSH, Sertoli cells, Leydig cells, spermatogenesis.
• (2) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
• (3) FSH, Leydig cells, Sertoli cells, spermiogenesis.
• (4) ICSH, Interstitial cells, Leydig cells, spermiogenesis.

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post-anal tail is absent.


Choose the most appropriate answer from the options given below:

• (1) B, D \& E only
• (2) B, C \& D only
• (3) A \& C only
• (4) A, B \& D only

Choose the correct statement given below regarding juxta medullary nephron.

• (1) Loop of Henle of juxta medullary nephron runs deep into medulla.
• (2) Juxta medullary nephrons outnumber the cortical nephrons.
• (3) Juxta medullary nephrons are located in the columns of Bertini.
• (4) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.


In the light of the above statements, choose the correct answer from the options given below:

• (1) Statement I is true but Statement II is false.
• (2) Statement I is false but Statement II is true.
• (3) Both Statement I and Statement II are true.
• (4) Both Statement I and Statement II are false.

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:

A. Substrate enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.


Choose the correct answer from the options given below:

• (1) B, A, C, D, E
• (2) E, D, C, B, A
• (3) E, A, B, C, D
• (4) A, E, B, D, C